Transcript

cdkn2aipnl-202

ID
ZDB-TSCRIPT-120213-518
Name
cdkn2aipnl-202
Previous Names
  • cdkn2aipnl-003
  • ch73-202g8.4-003
  • zgc:101768-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053337 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053337|OTTDARG00000037382|ZDB-GENE-041010-154 cdkn2aipnl|OTTDARP00000041964 CH73-202G8.4-003 LG_ FP017197.5 Danio rerio protein_coding KNOWN, 811 bp
ACAATGGCGTCCATGGATGTGGAGGAGTTTATCGGTCAGA
ACCGGCAGCTGGCTGACCGGGTTGAGGCTTTCCGCGGGTT
CTCGGAGAGCGACAAACACTGGAAGGGCAGGCGGGAGTTC
ATCTTCAGGAACATGGCGGACTTCCCGGAGCCGCAGGTGG
ATCATCTGCTCGCGCTCTCCATGGTCTGGCAGAACCACGT
GTTCATGGGCTGCAGATACAGCTCAGAGCTGCTGCAGAGG
GTGATGGAGATGGCGGAGGGCATCGAGGTGGAGGACGCTC
CAGTCTTCAAGACCAGAGATGAGATCATCAGACAGCAGAA
GGTCAGAATCTACACCTGAACACCAGCACTGCTAACATCA
GCGGCAGGCCTGTGCGATTTGGGGAAAACGTCTAATTGCA
ATTTAATTAATGTATTTATTAGACAGATACTGCCATTTCA
AGCTGCGATCTAATTGTGTGTTCAAGCTTCAGCTCAATGT
TCTGTATCTTAGCTTCTCATTCCTGCTAAAATGCAGTGAG
TGTCGGATCAAAACTGAAAAGATATTAACTGTAATTTGAC
AGTTATAAAAACGCATTGAAACGTGTGCGTGTTTTATAAT
ATGCTGTAATAAATGTAAACGTTTCTTATGATTTATCATG
TATATGTAGACAATACATCAAACATCAGAGGCCTCATGTA
TGAAGACTTGCGTGGAAATTATGTAAGAACATTGCGTACA
CTCACAGCTGTAAATGTGCGTACGCAGAAAATAATTCAGA
TGTATGAAACACTGCGTACGCCGAATCTCACACATATTCT
TTTGTACATCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations