ZFIN ID: ZDB-TSCRIPT-120213-476
Transcript Name: si:dkeyp-113d7.11-001
Previous Name: dkeyp-113d7.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053203 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053203|OTTDARG00000037300|ZDB-GENE-120215-127 si:dkeyp-113d7.11|no_translation DKEYP-113D7.11-001 LG_ BX323079.7 Danio rerio lincRNA NOVEL, 338 bp
GGTGTATCCCTCCGCGGCCACAACAAAAATGCAAATTGGA
ATTTCGTCGTGAATTTGAAATGCTTTTAATGGATATAATG
GACTCGAGAGACTTGAACTAAAGTCTGGAACAACAAAAAA
GCGGAGTTGAGGAATCACAAGTACAGTATAATGACTGCTA
TCAACATGCCGCAATTAAACATTTGCAAATCCATGGATCA
AAGGGAGAAGCTTCTTCCCGAAGTCTATCTGATTTCTTTC
TGTTACGCATGAGGAGACGAGACGGGCCTTTAATGTTCAC
ATTGCCTCGCCTCTCGAAATTAAACGGATGTCAGCGAAAT
AAAAACAAGGTTTGAGTG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-113d7.11-001 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER si:dkeyp-113d7.11-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053203 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH540378 (1) 378bp
    GenBank:EH561536 (1) 362bp
    CITATIONS (1)