Transcript

ompa-201

ID
ZDB-TSCRIPT-120213-433
Name
ompa-201
Previous Names
  • ompa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053012 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053012|OTTDARG00000037207|ZDB-GENE-050626-118 ompa|OTTDARP00000041687 ompa-001 LG_ CU928153.12 Danio rerio protein_coding KNOWN, 1019 bp
ATTCACACACAGAGAGAATCAGCAAAACAGCATCATGGGT
TCAGAAATGGAGCTGACATTCACTGAGGATCTGCAGCTGA
CAGAGGTGATGCGATTGCGTGTGCAGTCGCTCCAGCAGAA
GGGTCAGAAACGGCAGGACGGGGAGCGTCTCCTACTCCCA
CATGAATCCGTCTACCGGCTGGACTTCAGCGATCAGGATC
TGAGCTTCACCCGCTGGAACGTGAGTCTGCAGGGAACGGG
ACGCTTCACCGTCACCGGCATCTGCCAGCTCTGGACGCCC
GACCTGACCCACCTGATGACCCGCCAGCTGCTGGAGCCCA
TCGGACAGTTCTGGAGGAACGCCGGAGACCCAGAGGACTC
GCCCATCAAATGCCTGGAGGCGGATATTCAGGAGTTCGGG
GAGCGGATCGCGGAGCTGGCCCGCGTGCGCAAAGTCATGT
ATTTTCTGATCGCATTCAAGGAAGGAGCGACCAAAGAAAA
AATCTCCTGCTCTCTGACCTTCTGCAAAAACTGAGGCGCC
TTTTTTGTCAGGTCAGATGCGTAGTCTTTGTTTAGATCTA
GAGATTTGGGTCACACTTTACAATAAGGTTCATTAGTTAA
TGTTAATTAATGCATTTACTAAGATGAACAAACAATGAAC
AATACATTTACTACTGTATTTGTTAATGTTAGTCAATGTT
AGTTAATGAAAATACAGTAGTTCATTGTTAGTTCAACTAA
TGTTAACAAGCATGGACTTGGATGTTAATAATGCATCAGT
AAATGTTCAATTATGATTAATAAATGCTGTACATGTGCTG
TTTATGATTAGTTCATGTTAGTAAATGCATTAACTAATGA
ACCTTATTGTAAAGTGTTACCGAGATTGGTTTATTGTCCT
GTAGTAGGCCAGCATGTAAAGTCTTTTTAAAGCCTTGTCT
GCCTGTGGGATTGGCTTTAATGGGAAAGCATCTGAATATA
TTTACTAGTGCTGGGCAAAGATTAAATCACATCCAAAATA
AAAGTTTGTTTTGACATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations