header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-404
Transcript Name: pimr205-201
Previous Names: pimr205-001, dkey-37m8.13-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052755 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052755|OTTDARG00000037023|ZDB-GENE-120215-5 pimr205|OTTDARP00000041466 DKEY-37M8.13-001 LG_ BX005105.6 Danio rerio protein_coding PUTATIVE, 1231 bp
CTGTGCCTGTAATCCAGAACTCTGTTGATTCAGATCCAGA
GTCTGTCCCTGAAGTGTCTCTGGTCCAGAACTCTGTTGAT
TCAGATCCAGAGTCTGTGCCTGAAGTGCCTGTGATCCAGA
ACTCTGTTGATTCAGATCCAGAGTCTCTGCCTGGAGTGTC
TCTGGTCCAGAACTCTGTTGATTCAGATCCAGAGTCTGTG
CCTGGAGTGTCTGTGGTCCAGAACTCTGTTGATTCAGATC
CAGAGTCTGTGCCTGGAGTGCCTGTGGTCCAGAACTCTGT
TGATTCAGATCCAGAGTCTCTGCCTGGAGTGTCTCTGGTT
CAGAACTCTGTTGATTCAGATCCAGAGTCTGTGCCTGGAG
TGTCTGTGGTGCAGAATTCGGCCGAGTCGGAACCAGAGCC
TGTTCCTGGACCATCTGGGCTCCAGGAAACGGCAGATGTG
AAGTCGTCCTCTGCCTTAGGATCCTCTGAGTGTGATGCAA
ATACAGCACCTTTGCACAGTCTCTACAGCTTTGGAAAAGT
TCTGGGATCCGGGAGCTTCGGCACAACGTACAGAGCAGTC
CGTAAATCTGATGGCAAGGAGGTTGCCATCAAGAAGATTC
CCAAGAGAATGGACGACCGTCACATCTCTGCCCCTGGTTG
TTCCAAACCTGCGTATAAAGAAGCGGCGTATATGCTCATC
CTGAAAGATCCTACGCCGAGCATATACCTGATAGAACTGT
ACGAGTGGTTTGATCAAGAAGGATTCATTTCACTCGTCAT
GGAGTTCCCCAAACCTTGCGTATCCCTGCGGGAATATGTA
AAGAGTCATGGCAGGCTGACAGAAGAGGTCGCACGATACC
TGCTGCACCAGTTAGTCCAGGCAGTCGTGCACTGCATTGA
CCATGGCATTTCTCACAACGATCTGCATGAAGAAAACATC
CTGGTGAACACGGAGACTTTGGACCTCAAGCTGATCGACT
TCGGCTGTGCTTCCAAAATCAGGGAAGACCAATATGTGGA
TTACATCCGGGACGGCGTCTTTAACCTAGGCTACCTGCTG
CACTACATGGTGAATGCTAAAGCGCTACTGTACAGCGGGC
ATGGAGAGAGAAATCGACTTCAGTTTAACCCCAATTTATC
CAGCGAGTGCTGTGATCTGATAGAAAAGTGTGTGGAGGAA
CACTCGTGGACACTGGAGGACATCTTACAGCACGAGTGGA
TGAAGAAGCTGTTGATGAAGAGGGGATGAAG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pimr205-201 Contained in:
OTHER pimr205-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000052755 (1)
  • Ensembl_Trans:ENSDART00000150948 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT062310 (1) 758bp
    GenBank:EX155119 (1) 700bp
    GenBank:EV564858 (1) 569bp
    GenBank:CO356401 (1) 560bp
    CITATIONS (2)