Transcript

slc16a6b-201

ID
ZDB-TSCRIPT-120213-396
Name
slc16a6b-201
Previous Names
  • ch211-117c2.1-001
  • slc16a6b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050003 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050003|OTTDARG00000035176|ZDB-GENE-110208-3 slc16a6b|OTTDARP00000039246 CH211-117C2.1-001 LG_ CU855789.7 Danio rerio protein_coding KNOWN, 4909 bp
AACAGCAGACAGCTCTCGCGCCCGCGCTCAAATACCGGCT
TCAGCCGGTGTAAAATCTGCCAAGCTTCAGTGAAAGGAAA
CCAATAGAGAGAGCTGCTGGATAATACGTGATCCAGCTTC
AATATCGGTATTAATGAATTGTTAATGAAGTCAAACATAA
ACTAGGTAGCGATATATTTTTGAACGGGATCCTTTGCCCG
TGACTCGGTGAAGACTCACGCTCTCTCGTGACCGCGGATG
CAGAAAGCAGAAGTGATGTACTTGTACTCTACTTGACACT
TCAACACAGAAGACAGCCAGCGCTGTTGGCTTTTGTTTTC
TTTCAATAACTCGTTGTCAATTCTTCTTCAACGGTTCGAA
ACATCAGTGTCCATCATGTCCAGCCTGAAGGGCTGCATGA
GCCCCAATGTGTACTCTGAGGTGCCAGATGGAGGCTGGGG
CTGGATGGTGGCTGCTGCCTTCTTCTTTGTGGAGGTTTTC
ACCTACGGCATCATCAAGACTTTTGGAATCTTCCTCCAGG
ACCTCATGACAGAATTTCATGAAACCAACAGCAGAGTTTC
TTGGGCCGTGTCCATCTGCGTCTTTGTTATGGCCTTCACA
GCTCCTCTTTCTACGCTGCTGAGTAACCGTTTCGGCCATC
GGCCTGTGGTCATGGTTGGTGGATTCCTGATCAGCCTGGG
CACAATCACAACAGCCCTCACTCAGTCCATCGATGAGATG
TACATCACCATGGGCATTGTTGCAGGCCTGGGCTATTGTC
TGACCTTCCTGCCTACCGTCACCATCCTGTCGCAGTATTT
CAGCAAGCGCCGCTCGCTCGTCACCTCTATAGCCTCCACA
GGAGAGTGTTTCTCCATGCTCGCCTTCGCACCAGCCATGA
ATGCCCTGAAGGAGCAGATCGGCTGGCGTTACTGCTTGAT
GGTGATTGGGGTCCTGCAGGCCTCCATTATTGTCTGCGGG
GCTCTACTAAAGCCAATCGTCATCAAACCCAAACCCGCCA
CCCAGGAGGCGTCCACATCCCCCCTTAAAGTCCTCGACTC
CAAATACGATGCAGAGAATGAATTCACATGCACCTCCTTT
GACTCGGTGGACTCCGGTGTCCAGTCCATCTCCTCCTCAC
AGGTCAACCTGGCCAAAGAGCAGCAGAAGAAAGAGGAGGA
AGGAGAATCGCCAGAGACGCCTCTGAAACAGAAGCAGGAG
GACTCCAGTGTGTCCAGAACCAAACTTTTGGACTTCTCTG
TGCTCAGAGATGCCAGCTTTAACTGCTATGCACTGTTTGG
TCTGTTCGCAACACTGGGCTTCTTCGCACCACAGATCTAC
ATCATTCAGCTGAGTGTAAGTCGAGGAGTATCTCAGAAAA
GCGCCACCTACATGCTGTCCGCTATGGCCGTGGCTGAGAT
TGGGGGTCGTTTGTCCATGGGCTGGGTCCTCAATCGCAAG
CCCATCCGCAAAATCTACATCCTGCTGATCTGCACAGTGC
TGCTATGTCCGGTGCTGGTGGTCTTCACCTTCGTCTCAGA
GTTTTGGGGGCTCATGTCCTGTTCTTGTTTGTACGGGTTC
CTGCTGGGCACTGTGGCCTCCAGTCACATCCCCATGCTGG
CTGAAGATGACGTGATCGGGATTCAGAGAATGTCATCGGC
TGTCGGAGTTTACGTCTGCATTCAGAGCTTCGCAGGACTC
GCAGGTCCACCTCTAGGAGGTTTTCTGGTAGACCAGACTA
ATAATTATGGATCTGCCTTTTACTCCTGTGCGGCTGGGAT
GGGAGTCGGTGCTCTGTTTCTAGGACTGGTGCGTCCAGCG
AAAACTGGCCTCTGCTTTGGGAAGAGGAAGAGAAAGGACC
AGCAAAGTGCAGACAGAGACGCTTCTTCACAGGGCAGTGA
TGACAGCCCTGCTGACTTTGTAGAAATGGACATGGAGACT
GACAACAGTCCCGCAAAGAGCAAACCATGGCCAGTATGAA
TACAGGATCACCTGTTATCCTTCACTTGAACCATCAGATC
CAAAGGCTGCCAACCACACTCCCCCATCCCAACAGGGCAA
AATCCTCACAAATCAAACCTTACGTCAATTAAAGTAGTTT
AATCATTCTTCAACAGCACTTATGCTGAACATCCAGTCGT
AACATCCAGAATACGTTTACATCTCTTTTTTACTACTCGT
TATTTATTGAAGATTCAAAGCTCCTCGTTTACCAAAGTCT
CCAGCCTTTTCTATTTATTTTATTGTTTTAAATCGAGCAT
AAACCATCAAAATACTCTCAGCTTTACCATTTAAAGAAGA
AACCTCACGCTGTTTTGCTGCTAACATTGAGGCCATGATG
TGTATTTAGGTTTCAAAAGCCTCAATCAGAGTTGAAGATG
AGACTCCATCGAGCGTTCTCTCCAGGGTCTCTTCTTTAAT
TATTAACTAGTTTTTGCAGATGGAAACCAAAGTCAAGATG
CAGGATGTTTTCGACCAAAACACATTCCTGCATGAGACTT
TACAGAGGAAAAGTCTTCCATCAAGAAAAACTGATGTTAA
ATAAAAGGTTTCCGTCCTCAGATGTACAGTAGGTTATCTA
GTGTTTCCAATGGCTACAGAATGTCCTGTTACTGCTGTCG
TTTGGAATGAGCCGTCGGTGCCTTGCAGAATCACGAAAAG
CTTGTGACTTGAAGGAAGAAACTACTACAGGGGCTGTTCA
CTCAGAACACAGTCTGGCAGTGTTTATTTTGACGAAGCTT
TTAAAAAATATGACACTCGGGTGGAAAATGTTGGGAAATG
GAATAAGTCTATATAGAAAACCATTTAGAAGTAACGCAGA
GAAACACAAAAGAAGATAAGTCCCTAAAAGGTGAATCTTT
AACAATGTGGCGTAGGATTTGAAATGAATGGCGGCTGATA
GTAAAGAAAAAAAGCAACTGAAATTCTGGATGGGAGGTCA
ATCAAATTCCTCTGCACAACAAAATGAAACTATTATAGCT
CTTGTGATAGAAGTGGAATCTGAAATTCAGTTTTACACTA
AAGCCTTAAAACCAATCACAAACAATTCTGTTGAGCCGGG
CGTTGGGAGTTTTGTAGATCTCCCGCTAACAAATTTGCAG
TTTCAGTTTTTGCGTATATTGCTCTGAATTAACATCGTGG
ACCAACATGATTGCAACACGTGTTTCTCCTATTGTTTTTA
CGTCAGGTTTATTGATAAACTAATTTCGAGAGGATCACGT
GCTCATGACTGAACACAGCTGTTCATGCATTAGCCAATTC
ATGATCCACCAATCAGACGATTTATAAGTCACTATAAATA
CCCTAAGTTCCATATCGAAGCCATTTTTGTTTGAGGAATT
CCCTCGTCCACCCCTACACCTTTCCTAGAGCTAGTTCCTT
TCCTAGTGGTTAGCACTGTTGCCTCACAGCAAGAACGTCA
CTGGTTCTGGTCCTTACCAAGCCAGCCAACATTTCTGTGC
GGAGTTTACACATTTTCCCCATGCTCACATGGGTTTTCCC
CGGGACCACCTGTTTCTTCCAGAGACCAAAAAAATGCAAC
CTAAGTTAATTGACTAATCCAAATCGGCACCATAGACATG
CTCCTAGTAAGTAGTTTTATCTTAAGAGCAATCACTATCT
GTGCATTAGCAACTACAGGAGGGGAGTTCTCGAGATCTGC
CTGAGCTCAATCTCCCTTCTTGCCTTGCAAACGTGAGGGA
GCCCCGGGCTCGAGGATCTTATGAGCTTGGGGCTCTCTCC
TGGGACAGCATGCCAAACAAGCTTTATAATTAATCATCAG
CTAAGTTTGAACTCTTGAAATGAATTGTATTCATCGAGAT
CAAAAATCATCACGATATCAAGAGCAACAAAATCATTGTT
TTTTTTAATTGATGACTTGCTTTTGTCACACTAATGAATG
ACTTTTTATTCCTTAAGTAATAAATAACTTGCACTCCGTT
CTTAAACTAAGTTTTAGTACGAGTTTCTAGTATTCCGATT
CTAGTTAAGTATTTGACAAAAGACAATTTCAGTAACAATA
TAAAAAAAAACTTTTAGAGTTTAAGAGTTTAAAAAAAACC
CTGGACATCATTCCAGAAAGCAGACACTGCCGCTTAATGG
GAAAACCAGTTTCAGATCCTGATGCAGTGCAATAGACAGT
GGAAGAGCCAATCATAAGCATAGCCGTAGAATGAAAAAGA
AGAATAGGGAATAAAACAAAGCAACAAGTAGCATGGAAAA
TTGACAGAGATATCCGTTTAGTGCATGTTACAAGCAGTGT
TGTGAAAAGGCTGGCACTAAAAATGTTAAGTGGTGACAAA
ATGTATTTCTAAACAACAGCAGAGGGTGTTCTCTGAGAAG
CAGCCCCTAATTTCCTGCAAAGATGGTGAAGTGGTGTTTA
TTCGTCTCTAACACTGGCTGTTTAATGCTGCTCAGAGGTG
GCATGAATGCATTTACACAGCAGCTAAAATGGTATACTTA
CCAGTCTGGATATTGTGCAGCAGTCTCTGAATTATGAGCA
TGCAGAGAGCAGCATTAATCTGACTGTGTGAAGATGGCTG
AAGATAAAAACAATAGACTGTAGGATTGTTCTGTTAAACA
CTACATCAATGGCTGGAGAATGGAGGGTTTGATAAAAACA
AGACACAGATCGAGCAACGAAATATAAGCGCAAGAGATGA
GCCTGTGGGTTAATTCTGTAAGAAAAAAGTAGCACTTACT
TTTTGACTTGAACTCTTATGGACCTCCTATAATGTTCTGT
AAGCATGTTTCATTTGTCATATTTAAACGGTTTATTTTGT
ACTTTTAATGATAAGACACTGTGTGTGTTTTTTCCCTTTG
ATTTATGTTATTTGTGATGTACTATAGACTCTGCCTGAGA
CATGCTGCACTTCTGAATAATGCATTGAGAGAATGTTTAA
ATGTAGAATAAACTCAGTGATTATTTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations