Transcript

zgc:173742-202

ID
ZDB-TSCRIPT-120213-392
Name
zgc:173742-202
Previous Names
  • dkey-204j6.1-001
  • zgc:173742-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034179 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034179|OTTDARG00000025856|ZDB-GENE-120215-52 si:dkey-204j6.1|OTTDARP00000027577 DKEY-204J6.1-001 LG_ CU459124.4 Danio rerio protein_coding NOVEL, 673 bp
TGAAGGATAATGTGCCGGAGAAGTTGCTCTCCTATAACAG
GGCAAACCGTGCGGTTGCAGTTCTGTGTAACCATCAGCGG
GCGCCGCCAAAGTCCTTCGATCAGTCCATGGCCAACCTGC
AGGCAAAGATTGACAGCAGGAAGGAGCAGCTGGACTTGGC
TAAGAAAGAGCTCAAGCAGGCCAAGAAAGAAGCCAAAGGG
AGCTCAGACAACAAGCTGCTGGTTGTGGTGGAGAAGAAGA
AGAAAGCAGTCCAGAGGTGTGAGGAGCAGCTGCTGAAGAT
GGAGGTTCAGGCTACAGACAGAGAGGAGAACAAACAGATC
GCACTGAGCACCTCCAAACTCAACTACCTGGATCCACGCA
TCAGTGTGGCCTGGTGTAAGAACATGGAGGTGCCGCTGGA
CAAAATTTACAACAAAACCTTGAGGGATAAGTTTGCCTGG
GCAGTCGACATGACTGAACTTGACTTTGTGTTCTGAGTGT
GTTTGTTTATCCTACAATTCAGCCCAATATTTTATACCGT
GTTCATTGAAACCTTGAATTAAATCGTGTGGCTCTTGTGT
TCGTTCATATATTTTGCACATTTATATTGTTTTTTTTATA
TCGATTATTCAACTTTAGCTATTCTTAAGTATTTTAAGAC
AGTTTAATAAATGTTCATGCTTCATATGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations