ZFIN ID: ZDB-TSCRIPT-120213-379
Transcript Name: mettl7a-201
Previous Name: mettl7a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054839 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054839|OTTDARG00000038271|ZDB-GENE-061027-239 mettl7a|OTTDARP00000043021 mettl7a-001 LG_ CR388364.11 Danio rerio protein_coding KNOWN, 1838 bp
CTCTCTCGTCTATCAAACATGATTCAGATTTGATAGTCAT
ATAAAAATGTCGCTGTTTATGAACTTGTGCGCGTTTTTCT
GCAAACTCGTCGTGCTCCCGATGTACATCGCGGAGCAGGC
GGGACTCTTGTCTTTCTACAAACGCGTCTTTCCTATCATT
GTCTATAAAATCTCCTTCTCGTACAATGACAAAATGAACG
ACAAGAAACGGGAACTATTCCGAAACCTGGACCGATTTTA
CCCCTCGAAAGGCTCTCTGCGCATTCTGGAAGTGGGCTGC
GGATCTGGGGCGAACTTTGAGCACTACCCGACGGGCTCCA
AGATCACCTGCACAGACCCCAACCCGCATTTCAAGAAATA
CCTGGAGAAAAGTATGGAGAAGAACGAGCACCTGGTGTAC
GACAGCTTTATAGTGGCGTCGGGGGAGAATCTGCAGGCGG
TGGAGGACAGCTCGGTGGATGCTGTGGTTTGCACTCTGGT
TCTGTGCTCGGTCAAAGACACCAACAAAGTTCTGCAGGAG
GCAAAGAGGGTCCTGAGGCCTGGAGGAGCGTTTTTCTTTC
TTGAGCACGTGGTGTCAGACCCTTCAACCTGGGTTTACTT
TTTTCAACATGTTCTTCAGCCATTCTGGTACTTTTTTGGC
GATGGCTGTGAAACAACCCGTACTACTTGGAAGGACATTG
ACGCTGCAGGATTTTCAGATGTGAAGCTTCGCCACATTCA
AGCTCCTCTGTTTTTCATGATCAAACCACACATCGTTGGC
TATGCCGTCAAATAATCGATAGTAATATGAATTCTGCCAA
ACATACAAAAAAAATCTTAAGTGTGTTTTCGTTTAGTGAG
CCTGATTCATTTCACCATGCACTTTTAAATGTTTTTCTAT
GAGCAATGTTACATGCCATAGAATATAGTTTGTTTACCAT
GAATAGAGATTGCATTGTATATTTTATAAAACTGTATCTT
GCTGCATGAGTCTGCAAAACGCATGATAACTGAAGCCGAC
AAAAACACAAACGTGAACCAATGAAAGACATTCATCATAA
AACAGGCATTGGGATAATATGGTTTAAAAAAGCAACACTG
CCATCTAGTGGTCAGGGTGAATCACTAAGAAAAATAAACT
TAATTTTAACTTCTTCTGTACTAGCTAAAATAGTTAAAAG
CACCACAAGCATTGTCCACCTTTAACAGTTTGATTGACAT
TTTGATTTCCTGGCCACTGAATTTCCTTATTTTATGTTTG
ATTTTGGTTCAATAATTTATTTTTATTCACATAAAATTTA
AGAAATGCAATTAAAAAGGCTCTATTTATGAAAAGTCATT
TCTAGATGCTCCAACTGAATTTGACAAATGTATTTTTAGT
ACAAAATGCATTAATAGTTTTTTATATGCCTGGAAAAGAA
TATTTTATCATTACCGGATATTTTTATGCTGTTTGTGGCT
GTGGGAACTCATTACAACATACAGTGCTCAGCATATACGA
GTACACCCCTCACAAATCTTATAAAGTCTTATAAATTCAT
ATTTTTAGTAGGAAGCTACACAATATTATACTTGTGCATA
TACATTAGATTAGTCAGTACTGAAGCCAAATCTGGAGCTT
ATCTAACAAAATAACTTTTGATAATGCTCCAAAAACTAGA
ACACTCAAATTTATATGCTATAGAAAAATATTAAATACGA
ATTTAAAAAGGAAAAATCAAGAGAAGCAAAAAAAAAAAGA
TATTTTTTGTTGAAATGTTGTAGGTTGTAATTTTTTGTAT
TTAATTGTATTATCTTTGAATTTCTATATATATTTGGTGA
CGGAAATATTATTTTAATAAATATATCTGTTTAATGAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mettl7a-201 Contained in:
[BAC] CH211-173N18 (1)

Genome Resources: Vega_Trans:OTTDART00000054839 (1),  Ensembl_Trans:ENSDART00000086263 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124484 (1) 1863 nt
CITATIONS (2)