header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-347
Transcript Name: tgfbr3-201
Previous Names: tgfbr3-001, ch73-18k18.1-001, si:ch73-18k18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054569 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054569|OTTDARG00000038096|ZDB-GENE-120215-125 tgfbr3|OTTDARP00000042859 CH73-18K18.1-001 LG_none BX927081.20,AL929019.4,CU929229.9 Danio rerio protein_coding NOVEL, 3008 bp
CATGATAGATGTGAATCTCAACCTCCTCCTACTGGCCCCT
CCCACTAAAACGCACAGAGAGACAGAAAGCGGGAGAGGTA
TTTAAAACTTTTTGAGAACTGTCACAGGCTTTGTCATCCC
GAAAACCGTGGCGTTTGTCGCGGTATTAATTATTATACAA
ACAGAAGCGTATACTCGCCGCTCCTTTGCTGCACAAGCCG
AAGGAAAGGTTACTACGTGAACTCCCAAAGAAACTTTTCT
TCAGCACTAACTTACTGAAGATTTGGTGAGTGTGTGGGGA
GCATTCAAGAAGACACCCTGCTGCTTCAGTTTCTGCCACG
TCTGGCTTCAGGAAAGTGTTTTCTTCTAGCCATGTGGTTA
ACGGCACACATACACCCCTCCGCCATCCTGCTATTGACCC
TCAGCAGCCTGGCCTCTGCAGGTCCATTGTCTCGGAGCCC
TTGTGAACTTTTGCCAGTTGGTGTGGGTCACCCGGTTCAG
GCAATGTTAAAGAGTTTTACCGCCCTCTCAGGCTGCGCAA
GCAGAGGAACTACCAGCCACCCTCAGGAGGTGCACATCAT
CAACCTACGAAAAGGCAGTGCACAAGGAGCCAGAGAGAAA
ATGGCAGAGGTGGCGTTACATCTGCGGCCCATCCAGTCCC
TGCATGTGCACCAGAAACCACTGGTTTTCATCCTGAACTC
CCCTCAGCCCATCCTCTGGAAGGTCCGGACAGAGAAACTG
GCCCCAGGAGTTAAACGTATCTTCCATGTTGCAGAGGGAT
CTGAAGTGCACTTTGAGGTTGGGAATTTCTCAAAGTCGTG
TGAAGTGAAGGTGGAAACTCTTCCTCATGGCAATGAGCAT
CTGCTTAATTGGGCTCATCACCGCTACACTGCAGTTACAT
CTTTCAGTGAGCTCAGGATGGCCCATGACATCTACATCAA
GGTTGGAGAAGACCCTGTGTTCTCTGAGACCTGTAAAATC
GATAACAAATTCCTGTCTCTGAACTATCTGGCCAGCTACA
TCGAGCCCCAGCCATCCACAGGCTGTGTTCTCTCAGGTCC
TGATCATGAGCAGGAGGTTCATATCATTGAGCTTCAGGCA
CCAAACTCCAGCAGTGCATTCCAGGTGGATGTGATTGTGG
ATTTAAGGCCTCTGGATGGTGACATTCCACTTCATCGTGA
CGTCGTGTTGCTTCTGAAATGTGAGAAGTCAGTGAATTGG
GTGATCAAAGCCCACAAAGTCATGGGCAAACTGGAGATTA
TGACATCAGATACGGTCAGTCTGAGTGAAGACACAGAACG
GCTGATGCAGGTGTCAAAGACGGTCAAACAGAAACTGCCC
GCGGGGTCGCAGGCTCTCATCCAGTGGGCCGAAGAAAACG
GATTCAATCCCGTCACTTCATACACCAACACTCCTGTTGC
CAATCACTTCAATCTGCGCCTCAGAGAACAAGTTTCAGAT
GTGGGGATCATGGATGAGGGAATGTTGCCACCATTTTCCA
TTCTCCGCAACATCAATCCACTTCCAAAGCCCAGCGCCCG
GGATGCTCCTCCACGGAATGGTTTTCCTTTCCCCTTCCTG
CCTATGGACCAGGACCAGTCATTCCCTCCTTTGATGCCCC
CTCATGAGGATAGTGTTTTTCTGGCTGGGGGCCCCGAGGA
GCACCAGGGGTCTGCAGATGTAGGATTCAATGTGCAGTGT
GAGAAGAACAAAATGGTAGTCAGCATTGATAAGGAAACTC
TACAGGCCAATGGGTTTGGAAAACCCAATATAACTCTTCA
GGACTCACAATGCAAAGCAACCTCAAACGCCACCCATTAT
ATACTGGAGACGCCTCTGTCTGGCTGCCAAACCTCCAAAA
TCCCCTCGCACCCCAGCCCAGTGGTCCTCTACATCAATGC
AATTGTTATTAGCCAATCAGAGCAGAAAGATGGAAGTGGC
TGGCCTGTTGATGATGAAGATATGGAGCCTGGAGAAGTTT
TATTACCTGGAGATGCATTACCGGAGCTCACAGAACGAAT
TTTACCAGTAAACGGACATCATGCGACTATTTTGTTCAAC
TGCACCTACCGCAAGAACCAGGACAGTCCATTTGACACCG
ATGCTGGATCTGATGATTTTCTTGTAGACTCTACAGCCAA
TGTAACCTTCAACATGGAGCTTTATAACAACCACTTCCAG
TTCCCCAACAGCCAGCCGTTTCTCACAGTCACTGAGAACA
GACCTGTCTTTGTGGAGATTGCAGCCACAAAAGCTGACCC
CAACCTTGGCTTCATGATCCAGACCTGCTTCATATCTCCA
GACTCCAATCCTGCCGTGCAGTCGGAGTATGTTGTCATAG
AGAACATCTGTCCCAAGGATGACTCTGTGGTCTACTACCC
TCAGCGAGGAGATTTCCCCATTCCTCATGCTCAGATGGAC
AAAAAACGCTTCAGCTTCACCTACAGATCAAAGTTCAATG
TGTCATTGCTCTTCCTGCACTGTGAGATGTCGCTCTGCTC
CAGAAGAAATGACAAGGAGATGAACCTGGCCGAGTGTATG
TTACCGGATGAAGCCTGCACTTCCCTCAGTATAGAGAGCA
TCCTACTCATCATGATGAACACAAAGACCTTGACCAAACC
AATAGTGGTCATATCTGACGACATGCCAGTCACTATTAAG
GTCCCTCGGGAGGAAAGTCCACCACGTCAAGGCATCATAT
ATGTTTTGGACACCCCAACTGTGGTGGGCATCGCGTTTGC
TGCCTTTGTAATTGGAGCCCTTCTGACTGGAGCTCTATGG
TTTATCTACTCGCATACAGGTGGCACAGCTGCAGGACAGC
AGGTGCCGAGTTGTCCGCCAGTGTCTGAAAACAGCAGCGC
GGCTCACAGTATCGGCAGCACACAGAGCACACCGTGTTCA
AGCAGCAGCAACGCGTAGAACAGCTGGACTGACTTCTGCT
TGCAGTGCCATTTGTGGAAGAACATGTGAATAAGTAGCAC
AACAGGCCTTTTTATTTTCATTTTTTGAACTGAAATGTTT
AGGCTGAG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tgfbr3-201 Contained in:
OTHER tgfbr3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054569 (1)
  • Ensembl_Trans:ENSDART00000167482 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:FP137046 (1) 665bp
    GenBank:EB929718 (1) 616bp
    GenBank:EB978660 (1) 445bp
    CITATIONS (2)