Transcript

kcnh7-202

ID
ZDB-TSCRIPT-120213-323
Name
kcnh7-202
Previous Names
  • kcnh7-001
  • dkey-240h6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054437 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054437|OTTDARG00000038011|ZDB-GENE-120214-39 kcnh7|OTTDARP00000042763 DKEY-240H6.1-001 LG_none BX005368.11,CR847956.6 Danio rerio protein_coding NOVEL, 3489 bp
ATCATGCCGGTGCGACGGGGTCACGTCGCGCCACAGAACA
CCTTTCTCGGGATAATTATCCGCAAATTCGAGGGTCAAAA
CAAAAGATTTGTCATCGCCAACGCACGTGTCCAGAACTGT
GCCATCATCTACTGCAATGATGCCTTCTGTGAGATGACAG
GGTTTTCCCGGCCGGACGTCATGCAGAAGCCATGCACCTG
TGACTTTCTGCACGGACAGCTGACCAAGCGGCACGCTATT
GCACAGGTAGCGCAGGCTCTCATGGGCTCGGAGGAGCGTA
AAGTGGAGATCACCTACCACCGCAAGGACGGATCAGACTT
TCTGTGTGCGACACACATCATTCCAGTGAAGAACCAGGAG
GGTGTTGTTATGATGTTCATCTTGAGCTTCGATTATGTGC
TGAAGGAGGGCAGCATGGATTCATTAGACCGACTCAACCA
CACCTCCCCAGCCAGACAAGAACAAAAAAAAGGACGCTTC
TTCCGTTTTCGTCTGCCTGCGCCACTAAGCATGCTGGGAG
TCAGCAAGCAATCGCTCCCTCAGGAAGACCCGGACGAGGT
AACCATCCATTCGGCTGATCAAAACGAGAAACACTCTTCC
TGCTCGTCCTCTCTTTCTCTGTCCCTTTCTCCACGTGAGC
TCCACCCACCCACCGGCGAGAGCTGTAGCCCCTCCTACGG
AAACGACACCCGTGCTCTGATTGGCCAGAGTTATCTTGGG
TCTTGCTCGCCCATCTCAGGGCCACAGGATCACTCATCTC
CACGGGGCCCCTGGGAGCGTGTGGACCCTCAGGAGTCACT
CGCCACTGCGTCCAGGAGAGCATCACGGGCCAGTATGTGC
ACATTCAGGAGAGCATCTTCTACACAAGATTTAGAAGGAC
TCAGCACACACACACAGAGGACATACCGCGACCGCCACGC
TAGCGAAGGTCCATTTAATCAGATCAAGTCCAGCCTCCTG
GGCTCCACGTCTGACTCAAACCTGACCAAGTACAGCACCA
TCAACAAGATCCCACTCATCACTCTCAACTTCTCAGAAAC
CAACCATGACAAGCGGCCATCATCTCCACATTCCTCCGAG
AAAACCATCATCGCACCAAAGGTCAAGGATCGAACACATA
ACGTCACAGACAAAGTCACACAGGTGTTGTCGCTAGGCGC
CGATGTGCTTCCCGAGTATAAACTTCAGACGCCCCGCATC
AACAAGCTGACCATCTTGCACTACAGCCCCTTTAAGGCGG
TCTGGGATTGGCTGATCCTGCTGCTGGTCATCTACACTGC
CATTTTCACTCCCTACAGCGCGGCCTTCCTGCTCAATGAC
CCGGAGGAGGAGAAGAGGCGTGAGTGCGGTTATTCCTGCA
GTCCCCTCAATGTGGTGGACCTCATAGTGGACATTATGTT
TATCGTAGACATTCTTATCAATTTCCGGACTACGTACATC
AACGCCAACGAGGAGGTGGTCAGTCATCCGGCTAAGATAG
CAGTGCATTACTTTAAAGGGTGGTTCTTCATAGACATGGT
TGCTGCCATACCCTTTGACCTGCTCATATTTGAGGGCGGA
TCAGATGAGACCACTACTCTGATTGGCCTGTTGAAGACTG
CTCGACTGCTCCGATTGGTCCGTGTGGCTCGCAAGCTGGA
TCGATACTCCGAGTATGGGGCGGCTGTTCTAATGCTCCTC
ATGTGTATCTTTGCACTGATTGCCCATTGGTTGGCTTGCA
TATGGTATGCGATCGGCAATGTGGAGAGGCTCTATCTGGA
CCACACCATTGGCTGGTTGGATAATTTGGGCATATCCATC
GGCAAGCAGTACAACATAAGTGATGATGCCTCAGGCCCCT
CTATCAGGGACAAGTACGTGACAGCGCTGTATTTCACATT
CAGCAGTCTGACCAGTGTGGGCTTCGGAAATGTATCACCA
AATACAAACTCAGAGAAGATCTTCTCCATCTGTGTCATGC
TCATTGGCTCTCTGATGTATGCTAGTATCTTCGGGAATGT
GTCCGCTATCATTCAGCGATTGTACTCTGGAACAGCTCGG
TACCATCTGCAGATGCTTCGGGTCAAAGAATTCATTCGCT
TCCATCAGATCCCCAACCCGCTGAGACAAAGACTCGAGGA
GTACTTCCAGCACGCTTGGACATACACCAACGGCATCGAC
ATGAACATGGTATTGAAGGGTTTTCCAGAGTGCCTGCAGG
CTGATATCTGTCTCCACCTGAATAAAACGTTGCTCCAGAG
CTGCAAGGCCTTTCGTGGAGCGACCAAAGGTTGCCTTCGG
GCACTGGCGATGCGCTTTAAGACCACCCATGCCCCACCGG
GTGACACTCTGGTGCATGGTGGGGATGTTCTCACTGCCCT
CTACTTTCTCGCCAGAGGGTCTATCGAGATCCTCAGAGAT
GACATTGTGGTGGCCATCTTGGGTAAGAATGATATTTTTG
GAGAGATGATTCATCTCTACGCCAAGCCCGGGAAAGCCAA
CGCAGATGTTCGAGCGCTGAGCTACTGCGACCTGCACACC
ATCAACAGAGAGGATCTGCTGGAGGTTCTGGACATGTATC
CTGAATTCTCCGACTACTTCCTGTCCAATCTGGAGCTCAC
GTTCAACCTGCGGGATGAAAACAGCAAGGACACCACGGCT
CCCCAGAGGACCCTGTACACTGCTGTGAGTGACTCCGACA
CTGAAGACCCTGATGTGAGGAAGAGGAGACGCTCCACAGA
TTCTCCAATCAGGCCAAGCCGCTCCGACAGGGAAAGAGTA
AGAGATCGAGAGCTTCACACACTGCCAGGAAAAGAGGAGG
AGGAAGAGGATGAGGAAGAGACATCAAGGCCTTTGGGTTT
GGGTCAATCTCTTCCTGTCAACCTGAACACCATGCCTGAC
CCACACACTAAAGACTGTGTTGAAAACAATCTGTTTCAGA
AAGATGTGTGTGTTGAAGAATGGCCTTGTGGGAATGCAGA
TGACTCAGCGAAATCTCAGGACAGAGAAGGAGGAGACGAC
TGCGAAAGCGACATCACGTTCGGCGAAATGGAGCAACGAC
TGGATCTACTGCAGGAAAACCTGAACAGGCTGGAAGCGCA
GATGACTTCAGACATCCAGGCGGTTTTGCAGCTGCTCCAG
AGGCAGAGCGCTCTGGGTCCTCCAGCGTACAGCACTGTAG
CCGTCAGCCCAGAGTACCAGAAGCCCATACAGCCCGTCAC
TGCCATACAGACACAGAGTCCTGATCTAGAGAACGCCAAA
GACTCCAGGCCTGCTGTTCCCATAGAGACGACCTCTGATG
TCACCGCGGCGACTCCACTAGTGACGGACACACAGTGGGA
GGCGGAGCTTGGGCTGAAGCCTGCGGAGAACGAGGCGTCT
GCGTCACAGCAGCCCAGAGCGCTCCAGATGTCCATCAGAC
AGGCATCTCTCCCAGATTCAGCACCCGCTGCAGGCCACAC
ACCCGCTCTCCACAGGCCCTCCTCTGATCCCGGCCTTCCA
GGGCAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations