Transcript

si:dkey-261j15.2-201

ID
ZDB-TSCRIPT-120213-304
Name
si:dkey-261j15.2-201
Previous Names
  • dkey-261j15.2-001
  • si:dkey-261j15.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054356 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054356|OTTDARG00000037961|ZDB-GENE-120215-69 si:dkey-261j15.2|OTTDARP00000042699 DKEY-261J15.2-001 LG_ CR926129.9 Danio rerio protein_coding NOVEL, 1537 bp
TGATCACATATAGGCCCCAAAAAGTCCACTTACCTCCAGT
CAGGAACCCAAATCCACAGGCGGGTAAATATGACGTCACC
AGGAAACGATTTCAAAACAACAGCCTTTCTATCTGTAGCA
ACCACGCTGCTGTCTGCAGTGACCGTGCCTTTAACTGAAC
ATCCCACAAAATGTCCGAGGGTAAACACACGCTGTGGTCT
TCAGAGGAAATCAGCGTGCTGCTCGCGATATGGTCCTCCT
CAGAGATCCAGGAGAAGCTGGAGAGGTCGAAGAAGAAGCA
AATAGTGTACGACGAGATAAGCCAAGAAATGATGAACGGC
GGCTTCAATCGCTCGTCCGAGCAAATCGTAAACAAGCTGA
AAAAGCTTCGCAAGGAATATAGGGATCTGAAGATGAAACC
AAGCAAACGCGGCCGTGGAGGGCACAACAAGAGAACATTC
GACCACGGAGTTATGGAGTCGATTCTGGGAGACCGACCGT
CCAGTCATTTCACCAGGGCCTTGAATTCGGCTACGGCCAC
TGTGGAAACAAACCCCGAGTCGCCCGTGTGCTCTGAGGAT
GAAATAGGTAGTAAAGTACACGAGCACAAATCTGTACAAC
AATGGACTTCAAAAGAAACCAACACACTGCTCACCATATG
GTCTTCCACCGAATTCCAGGAAAGATTAGAAAAGTCGAAA
AGGCGGAAGAGAGTATATGAAGACATATGCCAGGAGATGG
TAAATGCTGGATTTACCCGTACAACTGAGCAAATCGTTAA
CAAAATCAAAAAACTTAAAAAGGAGTTAAAGGACCAGAAG
ATTGAACCAGGTAAAAGCAGCATCCAACTGAACATTAAAA
CCGATGAGGATGACAACCATATGGACAATGACCTGGAAAA
CTTACCAGCCAATCAATTGTCTGAAGCGTTAAATTCAGCA
TCAGCCATGCTTGAGATAAAGGCCGAATCGCTTTCTTCTG
CAGCTGATCTTGATGATGAAGTGCTGAACCAACCTGAAAC
GTCCCTCAGTTCATCTCAGACGCTAATAAAAAAGTCTTTG
GGATCAGGCAGAATAAGGAAGAACGATTCAAACCAGGAGC
TGCTTGACTATTTACAGACTGCTGATGAACGGTTTATGGC
GCACGCCAAAGAACTTAATACAGCCATTCTCAATAAAATG
GACGAAGCTACCAATTCTATGCTTGGACTTTTGGGACGCA
TGGTGACTCTAATGGAGGCACAGCAGGAAAACAAGCCATA
GACATGCACACTCAATTCATGTTTGCGCACAGAGTTAAAG
CTAAACTGAAATTGATTCTGTGTATGTAACATTTTTAACG
TGTTCCTCTGTTTTAAATGGTTATTTTGTATATTATAGAA
GTCATGGAATTTCATAACTTGTTCTATCCCTGAAATTGCT
TTTGTTTTTTCTTTACAACACCATCATCTTTGTTCATATG
GAAGTAGTGTTGCAAACAAAATTTGTCTCCTACAAAAGTG
GATTATTTTGGCATTCTGAGGTCTTGTCCACACTAACACT
GATATTTTCATAACCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations