ZFIN ID: ZDB-TSCRIPT-120213-297
Transcript Name: si:ch211-276a17.5-201
Previous Names: ch211-276a17.5-001, si:ch211-276a17.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054327 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054327|OTTDARG00000037948|ZDB-GENE-120215-248 si:ch211-276a17.5|OTTDARP00000042678 CH211-276A17.5-001 LG_ CR394534.6 Danio rerio protein_coding PUTATIVE, 4652 bp
TCACAGTCAGTCTGTCCATTCAAACAGAGGAAACGGGAAA
ACACAGTCCGCGTCCTTCGATGAGTCCTGATTTAAACTTT
TTATCTAACTGAACAGTTTAAAACGACATGATGCGTCGTT
TCTCTTCGACGACTGGACGCTCAGTTAGAAAGTTAAACTT
GGGATAAACTGCCTGGAGGACGAGTGCAATAAAGGAACTT
GCGTTATCACTGAAATTACACAAGCATGAATGCGATCAGG
CTGAACGCGTCCATGTCCGAGAACTCAATCTATCGTTTTG
CGGTTTACGAGAACCCGCTTTATGAGGAGTACAAACCCCC
GGCCAGGGACCTCATCCAGCTGCCCAGAGCCCTGCTGTAC
CTGCTCATGGCCGCCGTGGTGGTGGTCGCCGTTGCATATG
CCATCGTGGGACATTTAATCAAAGACCTCGCGCATGACAT
CTTAGATTGGGTTTTGGGTCCTGATGAGGAGATGTTAAAG
GCCAACAGTGAGGCGGGTGATAACGGTTCAACACACATGC
CCCAAGGCCTCACTCACTCCCACCCCAACGCCTTCCACGT
GTGGGATCAGGACGACGTGGTCATCCCGCTGTCCCCGGAG
GACAGTCCTCAGAACAGCCCTCTTCTGGCCGTCATCCCAT
TCATCCCTCACTTCTTTCCAGCCTCTCACAGTGTGCTCAA
CAGCCCCTCACTGCCACAGCCAGGAGAAAACAGGAGTCCC
ACTAAAACCACGCAAGACGCCTACGTCTTTCCTACACCCA
AAATCACCAGACAAAGCTCCACTTTTTCACATCATTCCGT
ATCATTCCACGACATGTAAAGGTTACATGACTGAACGCAA
ACTAAAGTGAAGTATATAAAAAACATACACTACCTGAGTA
GTCTTGTCGTTGATCCCAGTTGTAAGAGCAACAAAAAATG
AGGAAAAGTGGATCCTGCATGGACCCAAGTAACATAGAAA
TCAGTCAAGTTTGGTGAAGGAAAAATCATGGTTTGGGGTT
ACATTCAGTATGCAGGCGTGTGAGAGATCTGCAGAGTGGA
TGGCAAAATCAACAGCCTGAGGATGTAAAGACATTTGTGC
TGCCCATTACATTACAAAACACAGGAGAGGGCAAATTCTT
TAGCAGGATAGTGCTCCTCATACTTCAGCCTCCACATCAA
AGTTCCTGAAAGCAAAGAAGGTCAAGGTGCTCTAGCATTG
GTCAGCCCAGTCATCTGACATAACTATTATTGAGAATGTC
TGGGGTAAGATGGAGAAGGCATTGGAGATCAATCCAAAGA
ATCTTGATGAACTCTGGGAGTCCTGCAAGAACCCTTACTT
TGCCGTTCCAGATGACTTTATTAATAAGTTATCTGAGTCA
TTGCAGAGATGTATGGATGCAGTCCTCCAAGCTCATGGGA
GTCATACACAATATTAATTCTTTTTCCACTGCACCATGAC
TTTATATTTTATACTGTACATTATTTCTGTTGAGTGTCAA
GACTTTTGTCTCGGCAAAGGCAGAACTTATTGTCTTAATT
AAATAATAAAAAATCAAGACATGATCATACTTTATTGTGG
TAAAATAAGTGTAATCTAGAGGCCTTTGCCTTTCATATAA
ACCACTTCTGATACCAAATGATCAAATAGAAGTCAAGTTG
TTATTTGTTGTTCCTAAAATGTGTATAGGCAAGACTTTTA
TCAGGTAGTGTACATATAATAATTGGTAAAACTTTACAAT
AAGGTTCCATATGGCAGATAATTGATAACAAAAAAAAAGC
TCGCAAAAAAAGTTTTTGTTTCAGAAAGCTTGACAGATTG
GTCTGATTCTGAAATAGTGTTCTGGGGCAATGCTGTGGGT
TTTGAGTGTAAGACAAAATTGATCTGGCTATTTAATGTAC
ATTTTGACCATGGCCAATTTTTGCGCAGTATATTAAATTT
CACCAGACACTATTGAGTACTCTTAAAACACTTGAAATAT
GCTAAATATTTATGGGAGCATTTTGTGATATTATAAGCTC
AACTCTGGTCGCTATTCACTCATCCGTTATAAAGATGAAA
ATAAAAATCTTTTAAATCTACAGTCCAAAAAAGGAAGAAA
GAATTAAAACAAAACAAGAGAAGAGAAGAGAGTAAATGAC
CACTTTATTTCAAGTTTTGTGGTGAACTTTCTCTTTAGTT
GGTAAAATAAATAATACATTATAAAAAAAATACAAGTTAA
TATTATTAACTTTATATATTGTTATTTATATATAAAATAT
AACTTTATATTACTGCTAATATTTATTGAAAATGAACTTA
CAATGAACAGTTATCTGTCATTAGATGAATAAATACTGTA
ACAATTCAACAACCTGGATTTCATAACAGATTTGAGCAAA
ATTGAAATATTTTTTTGATGTGGACTCTACAAAGACTATT
GCAAAATCATGCTCTATTCCATTAACCAATTTAATACACG
TAAAACAACTCTTCCAACTCACGTCACAAAAGTTGTGACA
AGAAGTTTACATAGCCATTATATTGGTAACACTTTAGTTT
AGGTCACAATTCATGCCATTAGCTACTGATTTATTATCAT
TAAGATATTAATTGTTCACTAATTATAAATTCATTCATTT
ATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCTGTG
GTCACCACAGCGGAATGAACCGCCAACTTATCCAGCACCT
TTTTACGTAGCGGATGCCCTTCCAGCCGCAACCCATCTCT
GGGAAATAGTAGTTATAAAGTACGATCTTATTCTGCATCC
ATACCCAAAACCTAAGCCCAACCTTACTAACTAATAAAAA
ACAGCTAATTAGTAGTTCATTAAGCTAGTTGTGTTCGTTA
TTGGTTTGTTATTACCGTGAATTGTGACCTAAACTAAAGT
GTTACCATTATTTTTTAATCGAAGGAGACAGGGGTGTTAT
ATTTAGGTGTAATTATTGAATAATGTCATCTGCGAACTGT
GGATTCAGATTTGTTTTGGATTAGCAGTTCAAACTTTTTT
GAGTCAGGGAGCCAGTTTCTACAAATGAACGCATAGACAA
ACCTGTAAAGAATGATCAGACATTTTACATACGTCAAGTA
TCCAGTAAATGTGAAAAATATTTCCATTGCAGTTTTGAAT
CTCCTGTAAAAAAATTTTTTTTTTGAGAACTTGCTGCAAA
TTCATTAGATATTTTCATTCACGCAATATGACACTAAGGT
AATGAAAATGCAGCTAATGTTAATTACATAATTAATTAAT
GGAACATTATTGTAAATGATTACCAAACAGCTCCCCTAAA
AATGAAACTGTCATCATTTATGTAGGATGTTATATTCATT
CATTCATTTTGTTGAATTATTTATTTTAAGTAATGATCGA
ACATATTCAGCTTAGCATGATCCATTTCTTTAAATAGAAT
TAAAAAATAGATGGAACATTTTCTTTGACAAACACCCAAC
GAGGGTGTTGACTACATTTACCATCGCACCCTTTGCTTTT
CTACTCGTCTGCAAAAGCTGGGCTTTGTCCTGTGGAGTGT
GTGAGGATCAGTGACCTGTCCTCAAAATAGGTGCTGGTGA
CCACAAACAACCTCAATAAGCAGAGAGCCGTATCAGTCCA
AGCCGCATTACCGGAACGTGGTTGCCCGGTAAAACAGGGA
CAAGGCAGGACTGCAAAATCACGTCTGTAGGATTGTGCCA
ATTCAGGAGAAGCCTTCCCTCCTGGAGCCAAAATGCATCC
TCGGAACATATCTGAACCATCGGATCGTTCACTTTGACGC
AGGATAACCAGCGTTTGCAGTTCATGGATTTGCACGGAAA
TATTTTCGATTTTGTGCTTTATTTCAATAACCAGTGAAAC
TGGATTGGATTCAAAATCCAAAGTGTTACCGTCAAGAAAC
ATTGCAGGAGTGTGTCCATGCTCCTAAATAAACACTTTCA
AAGTGTTAAATGCACGCAAATAAACAAAAGTCTTTCTTTC
AAAAGGACTTTTTATTTTCAACAAACATTGTTAATAGTGA
CACCGCTGGTCATTAAGTGAACTGCAGCCAGCAACTTATT
GTGCACGGAGACTGAATGAGATTCAATGTCCTAAAATGTT
CAAAGGGGGTTAAAAAGAAGTTGGAAACGCTGTGATATAA
TGATAAAGAACATGTGAAGAGCAACATTTATGAATATGTA
TATAGTATGTGTTTCCTCTCTATAACATAAGCACAAAACA
CAACTGGTGAGAAAACAGCAGTAAAGAAAGCATCTGTTCA
TAGTGATATAGATATGTTTGCTCAAGCTGTGAAACTCACC
ATCAGTGTCAACGTCATTTAAATGACAAAGTCTGTAATGA
TTACAGTAGTGATTATTAATGATATATCTATAATGATATA
TTCACAGGGGTGCACTTAATGGTCGGAATACACGATTTAA
ATGAAAATTGTGCACTATATACGGCACTAGTGAAGCACTT
TTGTGGACCAATTCCGCTTCCTCATGAATACATATGAGGA
ACAAGCACCAACTCCAGCTTGATGTTGAGAACATTGATGA
TGTGCTCCCCTGTATATACAGATGCTTTTTATTCATCAAA
CATGGATATTATTGTACAGAATACCTGTATCTGCATTATC
TTAAGCATTTCATGTATCATAGAATGCAAATAAATATCAA
TTAATACTTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-276a17.5-201 Contained in:
OTHER si:ch211-276a17.5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054327 (1)
  • Ensembl_Trans:ENSDART00000151672 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN903736 (1) 835bp
    GenBank:CO914649 (1) 742bp
    GenBank:EB961687 (1) 624bp
    GenBank:EB956787 (1) 609bp
    GenBank:BI880367 (1) 577bp
    GenBank:BG306184 (1) 527bp
    GenBank:BF937987 (1) 451bp
    GenBank:CT628544 (1) 421bp
    CITATIONS (2)