ZFIN ID: ZDB-TSCRIPT-120213-246
Transcript Name: si:ch211-150o20.5-001
Previous Name: ch211-150o20.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053835 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053835|OTTDARG00000037615|ZDB-GENE-120215-6 si:ch211-150o20.5|no_translation CH211-150O20.5-001 LG_ BX572622.13 Danio rerio lincRNA NOVEL, 1006 bp
ATAGTGCATACGTAGATACAAATAAATGTTATTTTATAAA
AAATATCATATAAAAAACTCAAGGATTTTAGATCCTGATG
ATCGTTAAACGCGTCATAACAGTGTTGTGAAAAGGGTGTA
ATTGTTAAAAATAGGTACAAACATCAGATATAAACAAAAA
CCTAAACAAACACTTCTATGTACATAACGTCATAAAAATA
CTTGTTTTATGTACCTCGCGCTGCCGTCCTTGTACTGCCG
TGAACAGGAAATTCTGGGAATGGAGGACGGAGAGTTGAAT
CGATTCGTCTTCAACAAACCGATCAGTGTGACATCAAAAC
ATCGCGAGAACAACAGACAGCTCCGTGTGCATTTGAATCC
ATCTCGCGATATTGTATCACTTCAGGTACGCGCCTACTGA
TTCGTTGATTCAAACGAGTTGTGAATCAAGAAGCCTCTAA
AGATCCGAATCAAACTGCAGCAGCACGCCACGAGGTTTTG
CTCAGACTTTTGGGACGTTTGGAATTGCTCCGTCTTGTCA
CCATGTAACACATAGCAGCAAGACCCATGGGATTTCATCA
GCTACTCACCATCAGAGTCCTCAGTGGAAGCTGAGAAGAG
CAGAAGAGGAAGCCAAGCAAGAGATGCCAGAAAAAAGGGG
GAAGGAAATAATGTGTTATTTTGCTGTTTGAGTATAGGCA
GGCGCAGTGGGTAGCACAATCGCCTCACAGCAAGAAGGTC
GCTGGTTCGAGCCTCGGCTGGGTCAGTTGGCATTTCTGTG
TGGAGTTTGCATGTTCTCCCCATGTTAGCGTGGGTTTCCT
CCGGGTGCTCCCACAAGTCCAAAAATATGTGGTGACATTG
GGTAAGGTAAAATTGTCCGTAGTGTATGTGTGTGAATGAG
TATGTATGGATGTTTCCCAGTGATGGGTTGCAGCTGGGTG
GCAACACGGTGGCACAGTAGGTAGTGCTGTTTCCTCACAT
CAAGAAGGTTTCTGCATGGAGTTCTCCCTGCGTTCGCGTG
GGTTTC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-150o20.5-001 Contained in:
[BAC] CH211-150O20 (1)

Genome Resources: Vega_Trans:OTTDART00000053835 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DV600666 (1) 846 nt
GenBank:CV105964 (1) 837 nt
CITATIONS (1)