header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-19
Transcript Name: trim35-20-201
Previous Names: dkey-37m8.12-001, trim35-20-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052754 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052754|OTTDARG00000037022|ZDB-GENE-110920-8 trim35-20|OTTDARP00000041465 DKEY-37M8.12-001 LG_ BX005105.6 Danio rerio protein_coding PUTATIVE, 1656 bp
AAAATCAAACAGGAATCAGTGAAGAACAAAGAGGAAAACG
GATTATTGAGGATTTATTTCTGTACAGATTTCTGCAGATC
TGTGATTCTTTTGGTTTTTCTCTCTTAGAAAACATTCAGA
AAGTGAAAGTAAACTTGCTGGGACAGTGAAAATGGCTTCA
TCAGCTGAATATGATTATAGTTGTCCTGTGTGTCAGGATA
TCTTCAAGACTCCAGTTATATTATCATGTAGTCACAGTTT
CTGTAAAGAGTGTCTACAGCAGTTTTGGAAAATCAAGAAT
ACTCAGGAGTGTCCCGTCTGCAGGAGAAGATCCTCAAAAG
AAGATCCTCCAGTTAATCTGGGATTAAAAAATGTCTGTGA
GTCGTTCCTGGCGGAGAGAAATGAGAGACGTTCATCAGGA
TCTGAGGAGATCTGCAGTTTACACAGTGAGAAACTCAAAC
TCTTCTGTCTGGACGACAAACAGCCTGTGTGTTTAGTGTG
CAGAGATTCAACACAACACGACAATCATAAATTCAGACCC
ATCAGTGAAGTGGTGTCATCATATAAGGAGGAGCTCAATA
CAGCACTGAAGTCTTTACAGGAGAAATGTAAACTTAATGA
AGAGATGAAGAGAGAGTTTGAGAAAACAGCTCAACACATC
AAGGCTCAAGCTGAGCACACAGAGCGTCAGATTAAACAGC
AGTTTGAGAAGCTTCATCAGTTTCTCCGAGATGAAGAAGA
AGCTACAATCACTGCACTGAGGGAGGAAGAGGAGCAGAAG
AAGCAGATGATGAAGGAGAAGCTGGAGGAGATGAACACAC
ACATCTCAGCTCTTTCACACACGATCAAAGACACGGAGGA
GATGCTGAAAGCCAATGACGTCTGCTTTCTGAAGGAGTTT
CCAGTCTCAATGGAAAGAGTCCAGATCTCACAGCCGGATC
CACAGATGCCTTCTGGAGCTTTGATTCATGTGTCTCGCTA
CTTGGGCAACCTGCCGTTCAGAGTCTGGAAGAAGATGCAG
GACATTGTCCAGTACACTCCTGTTATCCTGGATCCAAACA
TTGCACATCCACAACTCCACCTGTCTGATGATCTGACCAG
AGTGACAATCAGAGAAATCAAACAACCAGTTCCTGATAAT
CCAGAGAGATTTGACTGTTATCTCTGTGTTTTGGGTTCAG
AGGGTTTTAACTCAGAAAAACACTGCTGGATCGTGGAGGT
TAAAGAGAGTCAACGCTGGAGTCTTGGAGTAACAACAGCA
TCAAACCAGAGGAAGGGAGATGTTTTCTTTAACTCTGATG
TCTGGTGTGTGTATTATGGATTGTCTGCAGAGTCTGCAGA
GTCTAGTTTTCGTGTTGATCAGGATCTTGATCGAGTGCGA
GTTGATCTGGATTATGACAGAGGAACAGTGTCTTTCTCTG
ATCCTGTAAAGAACAAACATCTACACACTTACACAACCAC
CTTCACTGATACTCTCTACCCTTTCTTCTGCTCTGTTTCC
TCTCTACAGATTTTAGCGTCCAGTGTTCAGTGAGATTACA
GCTGTAGTTCTGGATCTTCCTGTTTTCATCATGTCTCTAA
TATTTAATCAGGTCAATATGAGTGTGTTGATCTGAATATC
AGAATATCAATGTTTCAGGAAATTTACAAGAAATGAATCA
AAAGTGACAATAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
trim35-20-201 Contained in:
OTHER trim35-20-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000052754 (1)
  • Ensembl_Trans:ENSDART00000036273 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC154568 (1) 1749bp
    GenBank:BC077164 (1) 1690bp
    CITATIONS (2)