Transcript

rab24-201

ID
ZDB-TSCRIPT-120213-116
Name
rab24-201
Previous Names
  • rab24-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053284 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053284|OTTDARG00000037351|ZDB-GENE-050706-110 rab24|OTTDARP00000041918 rab24-001 LG_none CU694657.7,CU694492.18 Danio rerio protein_coding KNOWN, 1973 bp
GCTATTTGAGACACAACCTCATAGTGAAGTCACATCCTCC
TCTATATAAACAAAAAACACACTAGTTAATTCCACCTAGC
GATACACACTACAGTTCCTCATTTACCGAATACAGCCAAC
ATCTGTCAGACCTGTAGCCTTTTTTCCATGCCAACGGGAA
AACATGGCTCAGAAATTCTCCAGCTCTGCTGTATTTAGTG
ATGTTGAAAGCTAAGCTGCTCTTCTGTCGTTTAGGGCGAG
AATACACACATCAAATCACTAATTATTTAGTTTTTTATGT
TTTATTTGTATGTTTTTGTCCTCTGTTCGAAGTGTATTGT
GATTAACCGCTTATGTATTAATACATCAAGTAACGTTAGT
CTCCAATTTTAGTAGCTTTTGTGCCACATGAGAGTGGTTT
GCTAACTGGAACATTAGCTACCCAGTTACAACATTGGTCT
GTCAGTAAAGTCACTCTGGAAAGTTCCGTCAACAAATACA
GTGTCTATTTGCACAAACCCATATCATCATGACTGCCATG
CGAGTGGACGCTAAGGTTGTCATGCTTGGCAAAGAAAGCG
TTGGTAAAACCAGTCTGGTGGAGAGATATGTACATCGTCG
CTTTCTTGTGGGACCTTACCAAAATACTATAGGGGCTGCA
TTTGTTGCAAAAGCCCTCAATGTTGGTGAGAAGGTGATTA
CACTGGGAATATGGGACACCGCTGGGTCTGAACGTTATGA
AGCAATGAGCAGAATTTACTACAGAGGAGCTCGTGCTGCC
ATTGTCTGCTATGACTTGACTGACAGCAGCAGTTTTGGAA
GGGCCAGGTTCTGGGTGAAGGAGTTGCAGAACTGTGAGGA
GCACTGCAAAATATATCTATGTGGTACCAAAAGTGACCTG
ATTGAGGCGGACCGAAGCACGCGGCAAGTAGACTACCATG
ATGTTCAAGACTTTGCAGATGAAATAGGTGCACAACATTT
CGAGACGTCCAGCAAAACAGGAAAAAATGTTGATGAGGTG
TTTCAGAAGGTGGCTGAAGATTTTAGTAGCTGTGCTTTAG
AGTTCATGCAAGAGGAGAAGGGGGTGGATCTCGGGCAAAA
GAAGGACTCTTATTTTGACAACTGCTGCCATAACTGACCT
GTCAGAGGAAAAACTGCTGTATCATATGGTGTGATTTGGG
ATGCCTGGAAGCTCACAGATTTTTATACTCCTCAGTGCGT
CAGCCGGAGTGTTTGGCTTTTCTCCTTTTTCTTTGCTGTG
CAGTAGGTTGAGATTGAGTATTTGAAAATGAACTTTCTTC
TTTGTCAGGAACGCTTGTTTTTTTGGCACCTGAGAATCTT
GACTGAAGCAAATATCAAAAAGTGCATGGCAATCTATTTT
ACCAAAAAGGAAAGACACAAAGAGAGCTTTATGGGACAGA
TGCCATTGCATGGAGATCATCATTGCCAATTTTCACAAAC
AATGCCTTGAGTGATTCACCTTTTGTCATTTAAAGTTCTC
CATTTATAGATGTTTGATCATCGCAATGTTTACACCTTTC
ATTTATCACACTCTACTGATAATAGTCCACACTAAACTGG
AGCCATTTAAGTTGCGTTTTCCACAGATTTGAAACCAGTT
TATTTATTGTTCTTCATGAGTCATTTTGAATTCAATATCT
GGAAGATTCAGCATAACCAAGCGCTTCATGTAGTTTGCAA
CCTTGAATAATGGAGCCCAAAATTTCCTGCATCCTGCTGT
CTATTATTTGCAGTTTACTGATCTGTGCCACGTTCCAAAA
GCAAGTCAATATACAGCATTTGATGAATGTGACGTTAATG
TTTACACTCTTAATTTTATTATTTAATTTTACCTCAAGGG
TAAGATTTTGTTAACCGGGACACTAGCTTGTCTGTTGTGA
TCATGTTTGTGCGAACTTTGTACATAGTTTGCTTTCAGTT
CAAACTGTGCCTGTATTAAATGTGACTTAAAGAGGCCTGT
AGCTTAAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations