ZFIN ID: ZDB-TSCRIPT-120213-1150
Transcript Name: mettl7a-202
Previous Names: ch211-173n18.4-001, si:ch211-173n18.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054841 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054841|OTTDARG00000038273|ZDB-GENE-120215-64 si:ch211-173n18.4|OTTDARP00000043023 CH211-173N18.4-001 LG_ CR388364.11 Danio rerio protein_coding NOVEL, 1012 bp
CGCTTCCGGTCTCCGGATCTCCAGCGCTCGCCTGCGCGAC
TAGTCTTCTTAACCGAAAGTGTAGTTTCCCCGAGTTAAAA
ATGTCGCTGTTTTTGAACGCTCTTGCTTTCATATGCAAAG
TCCTCACACTGCCGCTGTTCGTTGGGGAGCGGGTGGGACT
TTTGTCTTTCTACAAGCGCCTTTACCCCCGACTTTTGAGT
AGTTTCACGATAGCGTACAATGAGCTAATGAATGACAAGA
AACGGGAACTATTCCTAAACCTGGAGCGATTTCAGCCCTC
CAAGGGCTCTTTGCGCATCCTGGAGGTGGGCTGCGGATCT
GGGGCGAACTTCGAGCACTACCCGACGGGCTCCAAGATCA
CCTGCACAGACCCCAACCCGCATTTTAAGACATACCTGGA
GAAAAGTATGGAGAAGAACGAGCACCTGGTGTACGACAGC
TTCATAGTGGCGTCGGGGGAGAATCTGCAGGCGGTGGAGG
ACAGCTCGGTGGATGCTGTGGTTTGCACTCTGGTTCTGTG
CACGGTCAAAGACACCAACAAAGTTCTGCAGGAGGCAAAA
AGGGTCCTGAGGCCTGGTGGAGCATTTTTCTTCCTTGAGC
ATGTGGTGTCAGACCCTTCAACCTGGGCTTACTTTTTTCA
GCATGTTCTCCAGCCATTTTGGTACTATCTTCAAGATGGC
TGTGAAGCAATCCGTGCTACATGGAAGGACATTGACAATG
CTGGATTTTCAGATGTGAAACTACGGCACATTCAAGCTCC
TCTGTTTTTTATGATCAAACCACACATCATTGGTTATGCA
GTAAAATAATGAATATGAATAATTTCCCACTACCTCCATA
GAAAAATCTTCCAAAGATTTTCTCAAGCACGTTTTCCTTC
AGCAAGCCCTAGTCATTTCACTTACTTTTAAGTATGTTTA
ACCAAAAACAAAAGAAAAAAAGGAATGTTTGTTCAACAAG
TGAAGACTTAACGTTTTGTTATTGCACAAGTATGTCTCTG
TAAAATAAACAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mettl7a-202 Contained in:
[BAC] CH211-173N18 (1)

Genome Resources: Vega_Trans:OTTDART00000054841 (1),  Ensembl_Trans:ENSDART00000086260 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH492691 (1) 1026 nt
GenBank:GO941811 (1) 789 nt
CITATIONS (2)