ZFIN ID: ZDB-TSCRIPT-120213-1026
Transcript Name: si:ch73-379f7.4-201
Previous Names: ch73-379f7.4-001, si:ch73-379f7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054118 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054118|OTTDARG00000037823|ZDB-GENE-120215-247 si:ch73-379f7.4|OTTDARP00000042519 CH73-379F7.4-001 LG_ FP015829.10 Danio rerio protein_coding NOVEL, 1020 bp
ATGAGTAACGCAGCTAATAGCAGCTCCACGGCTGGAGTTG
CAGGAGTAGTTTGGGTCACTCCACTTCTTGGCGCAACCCT
CGTCACCATGTGTGTTTTGGGATTGACTGGCAACCTCTAC
ACCCTCGCCATCATGCGTTCAGCAACATTACGGCGCGCCG
GATCAATGTACGTCTTCATCCTCAACCTCGCCACTGCAGA
CCTGCTCTATCTCGGCACCATCCCATTCGTCGTCTGCACC
TACTTTGCGCACGATTGGTTTTTCGGGGAGATGGGCTGCA
GGGTGCTGTTGAGTTTGGATTTGCTCACGATGCATGCAAG
CGTGTTTGTTTTGGTTGCGATGAGTATGGAGCGCTACCGT
GCAGTCGCCGCACCTTTTCGAGCACGTCTTTCGACCGCTC
GTGGACACTGGATGATGGCGTTGGGAATTTGGATTGCTGC
CTTCATCTTGACTCTTCCCATGATGGTCATGATTCGTCTT
CGAGAGGGACGTCCTGCAACTGTTGGACTCGTAAAGCGGA
TTTGTTTCCCAACGTGGACTCCTGAAGCGTTTAAAGCGTA
TCTGACTGCACTCTTCTTCACTAGCATGCTTTTACCTGGT
CTTCTCATGGTTGGTCTTTACGCTGGTTTGGCTAGACATT
ACTGGGCCGCCCAATCCAACCTCGCCCGAGGATCCTCATC
ATCTTTTCGAAGGCGTAGATTGAAGCATAAAGTCGTAGGA
ATGATCTTCTGCATCGTGGTCGCGTACTGGGCTTGTTTTC
TGCCGTTTTGGGGTTGGCAGATGGCGAAGCTTTTCTCATC
GGAGTCTTTGCGCTCGCTGTCGCCCGCTGCTCATACTTAT
GTTAACTTTTTTGTCACCTGTTTGACGTATGGGAATAGTT
GCGTGAACCCGTTGCTTTATACACTTCTAACACGCAACTA
TCGAGACTATTTAGCCCAGAGAGGGCAATCCTCTGGGTCG
AGTCGAGTGGATCAGGGGTCAGCCGCTGCGGTCAACATGA
TCCACGATCAAATTGGATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-379f7.4-201 Contained in:
[BAC] CH73-379F7 (1)

Genome Resources: Vega_Trans:OTTDART00000054118 (1),  Ensembl_Trans:ENSDART00000151009 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)