ZFIN ID: ZDB-TSCRIPT-110912-86
Transcript Name: znf1068-201
Previous Names: dkey-196n19.4-001, znf1068-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051489 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051489|OTTDARG00000036139|ZDB-GENE-080215-12 znf1068|OTTDARP00000040479 DKEY-196N19.4-001 LG_ CR846087.30 Danio rerio protein_coding PUTATIVE, 2094 bp
GATTCAACTGGAGAAAGGATAAAGTGTCCAAACACAGAGA
AAAACTCCTGCTGAAACGACTGATCTCCACACTGTTATAA
AGATGGCGTTTATTAAAGAGGAGAGTGAAGATGTGAAGAT
TGAGGAAACATTCACAGTCAAACAGGAAGATCTGCAGGAA
CAAACAGATCTGATGGTGCTGAAAGAAGAGACTCATCAAC
AGAATAAGATGGAAGAGAAACAGTTTGAGAAACACCAAGA
AACAACAACTGATGAAAAACCCACACTGACTAAAAAGACT
TCATCACGACGAAGACCTCGGAAATCCGAATCTGCGTGTA
ATTTAACTTGTCGTCAGTGTGGAAACCGTTTCAGGCGAAA
ACACAACCTTCAAATCCACATGAGAATTCACACTGGAGAG
AAGCCCTACACATGCCAACAGTGTGGACAATGCTTCTGTA
CTAGTGGAAACTTGGTAGTGCACATGAGACTTCACACTGG
GGAGAAGCCTTACTCTTGCCCTCAGTGTGGAAAGAGTTTT
AAGCATAATGGCAACCTTAAAGTCCACATGAGAACTCACA
CTGGAGAGAGGCCCTACACATGCCAACAGTGTGGACAATG
CTTCTATACTACAGGAAACTTGGCAGCGCACATGAGAATT
CACACTGGAGAGAGGCCGTACACATGCCAACAGTGTGGAA
AAAGCTTCTATCAATCAGCAAACTTGGCAGCGCACATGAG
AATTCACACTGGAGAGAGGCCGTACACATGCCAACAGTGT
GGAAAAAGCTTCTATCAATCAGCAAACTTGGTAGTGCACA
TGAGAATTCACACTGGGGAGAGGCCTTACTCTTGCCCTCA
GTGTGGAAAGAGTTTTAAGCAGAATAGCAACCTTGAAGCC
CACATAAGAACTCACAATGGAGGCAGAAGTTTTACTTGCC
CACAGTGTGGGAAAAGTTTTGCTCAAAAGCAAGACCTTGA
CCTCCACATGAGGATTCACACTGGAGAGAAACCTTACACA
TGCACAGAGTGTGGTAAAAGTTTCAGATGTAAAAGTGCAC
TCAATAACCACATGATAAGTCACACTGGAGAGAAGCCATT
TACATGTGCTCAGTGTGGAAAGAGCTTCACAACCAAAACT
AGCCTCAAGAACCACATGAATGGTCACACTGGAACCATAG
TGTTCACATGTGATCAATGTGGAAAGAGTCTCACACGCAA
AGACACAATTAGGAACCACATGAAGACTCACTCAGGAGAG
GATGGTTTTAGATGCAGTGAGTGTGGAAAGGGCTTTAAAT
ATAAAAAAAGCCTCAACACTCACATAAAGCTTCACAATGG
AGATCAGAGTCCTCAAAATTGAGCCTTTGTCCAGCGGAGC
TTAGGGCTGTCCCCCAGGACAGCATGCCAAACAAGTGCGA
ACTCTTGAATACATGTCAAGTTATTGGAAATAAAACCCTT
TGAACACCTGAAGATTTAAACTCAATAACTAAAGAGGTGA
AGACTTTTTTTTGTAGTGTAGATCATGGGTCACAGCGCAG
TACCAGGTTGTTAGAGTTTCAACTTTATAATGAACCAATA
ACCATATTTTTGCACATTGCACACATCCATCAATTGGTTG
GCACTGAAAAGAAAATTAGAAAGATTAAGGATGAGAAACT
GTCCTACACCCTTAGACTGTTTTTTTGATCATTCACATTG
TTTGATTGTCACTCGTGTGAACAAACACCGATTTGCCTCC
AGTTTTGGGCTTTTGTCTGCAGTTTCACAAAACTTGTTGG
CAAATGAAAGTCCACCTAAACTCGGCCGGTGTGAACTCGC
CATGAGGCAATGACAGTGAGCGACTGATGCAGACTCCCTA
AAACCCTGTTCAGACTACACAATGCCATTTGCCATTTACC
ACAGATCAGATTTGTGTCAGATTATGAGATTTTGACTTGA
TGTGTTGTGGTAAGAAATGAAGACTTTGGTTTCAAAACAA
TACACTTTAATTTTGATTGACTGATTTGAGAAAAGAAACA
AGTTTTCTTCATGAAGACAATTAAACTTTCTGTAGACAAC
AAGATACGTTAGTGTGAAAACTCCCACATTACTACAAATA
AATCTGTGTATGGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf1068-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051489 (1),  Ensembl_Trans:ENSDART00000108499 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154171 (1) 2117 nt
CITATIONS (2)