Transcript

si:ch211-148l7.4-202

ID
ZDB-TSCRIPT-110912-835
Name
si:ch211-148l7.4-202
Previous Names
  • ch211-148l7.4-001
  • ottdart00000052123
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052123 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052123|OTTDARG00000036569|ZDB-GENE-090313-38 si:ch211-148l7.4|OTTDARP00000040966 DKEY-190G6.4-001 LG_ CR381531.7 Danio rerio protein_coding NOVEL, 1710 bp
CTCGCAATGGATGATGGGAGTTGTAGTTTGCCAAACTGCC
TGAACTAAGTTAGAAGCGCGTGGTTGTAGAAGTGACAGTC
CGTTTGCATCTCGCTTCAGAATTTCGTGCATTTAACGTTA
TTGAACCTCAGAACAGCCGTTGCAATGTCCACAAATACGG
TCGAGAGACCCATGTTGTGCGATACAACGTCATCGAGTGG
GAATATGGAGTCCGTACACTGCAACTGGAGGAATGTATCA
CGAGCTAATCAGATCTCTAAAAGATCAAGACCCATGTCCG
AAACCTTATCCAAACTGGCTCAGCTCATCACCTGCATGGA
GTACAAACCAAAATCACAAACGTCTTCCTCCATCTGCAAG
GACGCCAGCCAGAAACCCTCCGAAATGAACGCTCTTGTGC
GTCACCAGCAAAAAGAGCGCACCCTGCAAAAACTCCACAG
CTGTCAACGGTGTAACCAACAGTTCGCTTTGCTTTCCAGT
CTGCAGTTACACAAATGCCCTCGTTCTTTATCCGTGTGCC
AAACATGCAATGGGAAAATGCCAAAGGGATCTTCATGCGC
CTCCTGTGGGAGTAAACCCTCAGTTCCCAACTGCACAGAA
GATCCCATCCATCAAGGCAACAGCCCATGCGGACAAGCCT
TCAGCCACAAACAAGATCTGCTCCACCACCAGCAGGCCGG
AGACTGTCAGCCTGCGAACACTCTCAAAGCTGCTTCCTTG
CCACCATTTAAACAAAAAGCCACATGCACCCTGTGCTCTA
AAACTTTCCGTGCCCCCAGAGGTCTTGCCTGCCACATGCG
CTTTTCCCACGCACCAAGAAAAAGAAGCGCGAATTTAGAA
AAGGATGTGCATTTTGGGAATATGGAGAGGAATGAGAGCG
TCTCGAGTGCGCTCTTTCAATGCCGTTCCTGTGATAAATC
GTTTTCCAAGACATCGCTTCTCCATCGGCATAGGAAGGAA
GAACACAGACGGGATGTAAAGGTGAGGAATACGTTTAGAA
ACTCAGGGAAGATCACCAGACGGAAGCGGAAAAGTGGGAT
ATATCCATGCCTGCACTGCGGAGCCGAGTTCCTGCATCAT
CTGACAAGATTGGCGCATTTTAGAAACTACACCGTCCACC
ATGAGATGCACCTCAAATTAAGTAACAAATCAACCGGTGT
TTATGCAACCGCTGCTAAGCTCAAGCTGAAGCCCGCAAGA
AAGCTCCAAAAAGATAAACCTGAAGGGAAGAAAGGAAGAC
CGAAGAAAGTTCTCCCTGTTCACATTGAGGAAACTAAAGA
AGAGGAGGAAGTGGAAGAGAATACACTGGAAGATGATAGT
GATGATGATGAGGAAGACGAGGATGCCGAGTACCCTTGTA
CATCATGCGATCAGGTCTTCAGTTCCACAGCTGCTCTGTT
TGTTCATGAGAAAATCCATGATCAGTTGCCGGCGGAAGTA
GATGATGAGCCGGCCGAGACGTGCAGGTGTTGTAGTGTGT
GTTCAGGCGGGATTCCTCTACACATGCTTCCTGAAGATGG
CTTCGAGGGGGAAGTCTATCACTGTGTGCCATGTGCTGAG
ACCTTCAAAGCTCTGGATGCTTTTCTAGAGCACTGCCAGA
AACATCTGATACGTGAACATGAGGATGAGTTCAGTGATGA
CTGAAAGAGTTTGCTTTTTTGCCATTTTTTCCTCTTGAGA
ACAAAAGATAGTTGCATATTATTAGACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations