ZFIN ID: ZDB-TSCRIPT-110912-666
Transcript Name: si:dkeyp-35e5.10-202
Previous Names: dkeyp-35e5.10-001, si:dkeyp-35e5.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051428 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051428|OTTDARG00000036093|ZDB-GENE-110913-63 si:dkeyp-35e5.10|OTTDARP00000040433 DKEYP-35E5.10-001 LG_ BX294383.7 Danio rerio protein_coding NOVEL, 1633 bp
ACGTGACGTCATCAGGCGGCGCCGCTACAGCGCGGTGATT
CAACTGGAGAAAGGATAAAGTGTCCAAACTCAGAGAAAAA
CTCCTGCTGAAGCGACTGATCTCCACACTGTTATAAAGAT
GGCGTTTATTAAAGAAGAGAGTGAAGATGTGAAGATTGAA
GAAACATTCACAGTCAAACAGGAAGATCTGCAGGAACAAA
CAGACCTGATGGTGCTGAAAGAAGAGACTCAACAATGGAA
TAAAATGGAAGAGCAACACCAAGAAATAACAGCTGATGAA
AAACCCACACTGACTGAAAAGACTTCATCACTCGGAAGAT
CTCGGAAATCCAAAACTGAGTGTAATTTCAGCAGTAAACA
GTGTAGAAAGAGTTTCAGTCAAAAGCCTAACCTTGGTGTT
CACATGAGAGTTCACATTAGGGAGAAACCTTACACTTGCG
ATCAGTGTGGAAAGAGTTTTGGTAAAAAAAAAAGCTTCAA
AACCCACATGAGAATTCACACTGGAGAGAGGCCGTACACA
TGCCAAGAGTGTGGAAAAAGCTTCTGTCAAGCAGAAAACT
TTGCAGTGCACAAAAGAATTCACACTGGAGAGAGGCCCTA
CACATGCCAACAGTGTGGAAAGAGTTTTACGCAAAGTGGC
AACCTTAAAGACCACATTAGAACTCACAATGGAGGAAAAA
AATTTACTTGCACACAGTGTGGAAAAAGTTTTGCTCAAAA
ACAAAAGCTTGACACCCACATGATGATCCACACTGGAGAG
AAACCTTACAGATTTACAGAGTGTGGTAAAAGTTTCACAT
GTAAAAGCGCACTCAATAACCACATGATAAGTCACACTGG
AGAAAAGCCGTTTGCATGTGCTCAGTGTGGAAAGAGCTTC
ACAACCAAAACTAGCCTCATGAACCACATGGATGGTCACT
CTGGAATCATAGTGTTCATATGTGATCAGTGTGGAAAGAG
TCTCACACGCAAAGACTACATTAAGCAACACATGAAGACT
CACTCAAGAGAGGATCGTTTTAGATGCAGTGAGTGTGGAA
AAGGCTTTAAACAAAAAATAAACCTCAGCGCTCACATGAA
GCTTCACAATGCAGAGCAGAGTCCTCAACATTGAGACCTT
GTCCACACAAACACGAGTATATTGAAAACGGCAGCTTTTT
CATGTAGTTTGGCTGTTCATTGACATGAAGTTTATTTATA
AACTACTTTCGAGAGGATCACATGCTTATTATTGTTCACG
ACTGGTCCAGCATTGGCTAACACGATTCACCAATCGGATG
ATTCCTGGCGCCCTATAAAGGACAAGAGATTCTTACCTCT
GTTATCTTCGTCGTTATCTTTTATACTCACTAAAGCCCTG
TTCAGACTACACAATGCCATTTGTCAGTTACGACAGATGA
GATTTGTGTCAGATTATGAGATTTTGACTTGATCAAATCT
TGATGTGTTGTGGGTAACAAATGAAGACTTTGGTTTTAAA
ACACTACACATTTATTTTGATGGACTCATCTCTGAAAAGA
AACAAGTTTTCTTCATGAAGACAATTAAACTTTCTATAGA
CAACTGCTCGCCTTTAAATATACGTTCATATGAAAACTCC
AACATTACTTCAAATAAATCGTTGAATGGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-35e5.10-202 Contained in:
[BAC] DKEYP-35E5 (1)

Genome Resources: Vega_Trans:OTTDART00000051428 (1),  Ensembl_Trans:ENSDART00000166022 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155250 (1) 1672 nt
CITATIONS (2)