ZFIN ID: ZDB-TSCRIPT-110912-620
Transcript Name: si:ch73-266f23.3-201
Previous Names: ch73-266f23.3-001, si:ch73-266f23.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051239 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051239|OTTDARG00000035949|ZDB-GENE-110914-182 si:ch73-266f23.3|OTTDARP00000040271 CH73-266F23.3-001 LG_ CU694452.16 Danio rerio protein_coding PUTATIVE, 752 bp
ACGCCGCGCCGCGCTCCTGAATGTGCAGCTCAACAAAAGG
ACAAAGTGTCCAAACACAGAGGAAAACTCCTGCTGAAGCG
ACTGATCTTCACACTGTTATAAAGATGGCGTTCATTAAAG
AGGAGAGTGAAGACCTGATGATTGAAGAAACATTCGCAGT
CAAACAGGAAGATCCTGAACAAACAGAGCTTATGGGCCTG
AAAGAAGAGACTCAAGAGCCGAATGAAATGGAGGAGAAAG
ATCAGTTTGAGAAACGGCAAGATTACATGTGTCGGCAGTG
TGGAAAGGGTTTCAGTTACAAACAGAACCTTAAGGTCCAC
TTGGGTATTCACTCTGGAAAGAGGCCTTTCAGATGTGGTC
AGTGTGGCAAGAGTTTCAGTCAAAAGCAAGCCCTCGAAGG
TCACATGAGAGTTCACACCAGAGAGAGGCCTTACTCCTGC
ACGCAGTGTGGAAAGAGTTTCACTCACAAACACCACCTCC
AGCACCATATTAGGATTCACACCGGAGAGAGGCCGTACGC
CTGCACACAGTGCGGAAAGAGATTCAACCAGTTGCAAGTC
CTTAAAAACCACCTCACGATTCACACTAAAGTCAAGCCTC
ATGCTTGCACTCAGTGTGGGAAGAGTTTCAGTTTAAAGAA
TAGACTCGAGATGCACATGAGAGTTCACACTAGAGAGAAA
ACAAGCACTTGCCCTCATTGTGAAAAGGTTTTCACTCGAA
AAAGCAACCTAACTTTACACATGAGGATTCAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-266f23.3-201 Contained in:
[BAC] CH73-42B22 (1)

Genome Resources: Vega_Trans:OTTDART00000051239 (1),  Ensembl_Trans:ENSDART00000150704 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DV592819 (1) 796 nt
GenBank:CB363556 (1) 607 nt
CITATIONS (2)