ZFIN ID: ZDB-TSCRIPT-110912-617
Transcript Name: znf1059-201
Previous Names: dkey-13e3.2-001, znf1059-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051208 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051208|OTTDARG00000035919|ZDB-GENE-110913-24 si:dkey-13e3.2|OTTDARP00000040241 DKEY-69C19.2-001 LG_ BX088538.26 Danio rerio protein_coding KNOWN, 2644 bp
CTCTTGCGCCGTGATTTCACTGGAGAAAGGATACATTGTC
CAAACGCAGAGGAAAAACTCCTGCTGAAGCGACTGATTTC
CACACTGTTATAAAGATGGCGTTTATTAAAGAGGAGAGTG
AAGATGTGAAGATTGAAGAAACATTCTCAGTCAAACAGGA
AGATCTGCAGGAACAAACAGACCTGATGGTGCTGAAAACA
GAGACTCAACAATGGAATGAAATGGAAGAGAAACAGTTTG
AGAAACAGCAAGAAATAACTGATGAAAAACCCACACTGAC
TGAAAAGACTTCATCACACGGAAGACCTCGGAATTCCAAA
TCTGCATGTAATTTTACTTGTCGTCAGTGTGGAAACCGTT
TTAGTCGAAAACACAATCTTCAAGTCCACATGAGAATTCA
CTCTGGAGAGAAGCCCTACACATGCCAACAGTGTGGACAA
TGCTTCTGTACTAGTGGAAACTTGGTAGTCCACATGAGAA
TTCACACTGGGGAGAAGCCTTACTCCTGCTCTCAATGTGG
AAAGAGTTTTAAGCAAATTAGCAATCTTAAAGTCCACATG
AGAACACACACTGGAGAGAGGCCGTACGAATGCCAACAAT
GTGGACAGCGCTTCTATACTACAGGAAACTTTGCACAGCA
CATGAGAATTCACACTGGAGTGGGGCTGTACCCATGCCTA
CAGTGTGGAAAAAGCTTCCATCAATCAGCAAACTTGGTAG
CGCACATGAGAATTCACACTGGGGAGAGGCCTTACTCTTG
CATTCAGTGTGGAAAGAGTTTTAAGCAAAATAGCAACCTT
GAAGCCCACATGAGAATTCACACTGGAGGAAGAATTTTTA
CTTGCACACAGTGTGGGAAAAGTTTTGCTCAAAAGCAAGA
CCTTGAGATCCACATAAGGGTTCACACTGGAGAGAAACCT
TACACATGCACAGAGTGTAGTAAAAGTTTCAGATATAAAA
GCACACTCAAACACCACATGATAAGTCACACCGGGGAGAA
GCCGTTTACATGTGCTCAGTGTGGAAAGAGCTTCACAACC
AAAGCTAGCCTCATGAACCACATGAATGGTCACACTGGAA
CCACAGTGTTCACATGTGATCAGTGTGGAAAGAGCCTCAC
ACGCAAAGACACCATTAGGCAACACATGAAGACTCACTTA
GGAGAGGATTGTTTTAGATGCAGTGAGTGTGGAAAGGGCT
TTAAATGTAAAAGAAGCCTCAGCACTCACATGAAGCTTCA
CAATGGAGATCAGAGTCCTCAAAATTGAGGGTTAGTCAAG
CAGAGCTTAGGGCTCTCTCCCGGGACAGCATGCTAAACAA
GTTTGTACTCTTGAATACATATCAAGTTACTGAAAATGAA
ACCCTTTGAACATCTGAAGATTTAAACTCAGGGTGCTTTC
ACAGCTACACTTTTGTTTCGGAACCTGTCTCGTTTGCCCA
GTTAGCGCGGTTCGTTTGGCATATGTGAAACCAACAAATT
GCTCTAGGATCTGCGCCAAATCATCACTCCAAGTTCGCTT
GAATGAGGTGGTCTCGGCTTGATTGAAACGCACTCTGGAG
CGGATCGATTGCAGTGAGAAAGCGATACAATCCGAGCGCG
GTTATATCACAGTGTATTATGGATATGTAATAGGCATACG
GCTATATGAAGAAAGAATTATCTCCCGACTACCTCCCGGT
CCTCAAATAGGCTACGTCGCGCACCCTTCTCACCCCTCCC
CACCGCATCTCTCCTCAGACACGTCGCGCGCACCTTGTCA
CACACCATTAAAACACCACCTCTCCTGACAACTGAGCAGG
ACTCTGCAAAATAAACCCTGACACTCTGACCAATGTGAGT
TAGAGTTTACTCACACGGGACTTGTTTTAGCTCTTTTGGT
CCAATTAGAAACTTTGCAGTGTGGAAGCGAACTGCTCCAA
GAGCATAGAGCAACAATATAACATTTGTAATCTCTGTTTC
GGAACAACTGAGTCGATTCACAGGTGTGAAAGCACCCTCA
ATAACTGAGGAGGGGTGAAGATTTTTATTTTTATTTTATT
TTTTTAAGTGTAGATCATGAGTCACAGCGCAGTTCCAGGT
TGTAAGAATTTTAACTTCATAATGAAATTATAACTAGGCC
CACAGAGATTCAGCATGGGCAGAATTCTGCAGATTTTTAA
CCCATCAAAAATTCTTTTTACAACCCCAACCCCAAAAAAG
TTTTTTACTTGAGTAAATGTGTGTAAATCTATATTTATTC
AGTTTTTTATTATTATTACCGTATTAACATTGACTAATGT
GAAAATGTTCATCTGATTTATGTACAATGCAGTTTGTAAA
GTAGTATTGTCTTTTAGTAGAGATATTATATGAGAGACTT
GCTTTGTTTACCAAACAAGTGCCAAAAAAAAAAAGAGATG
GAAGAGAAACATTGTGACATACACAACAGAATATTGTGGA
AGAATACCTCTGATCAATACTATAATGTTTTATGAATAAC
ATTGATAATTGTGTAAAACTCTTTAGTTGACAAACAAAAC
CATGTTTTAAGTCTAAGCTGTTGTAATTAAGAATGTCACC
GTGGCTATCCATCATATCCAATAAAGAAAACAATATTATT
TCTAACCTAATTTTTACAAAATAAAGACTTATTTCAATAT
AAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf1059-201 Contained in:
[BAC] DKEY-69C19 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000051208 (1),  Ensembl_Trans:ENSDART00000110358 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155737 (1) 2662 nt
GenBank:CK026927 (1) 755 nt
CITATIONS (2)