Transcript

zgc:194101-201

ID
ZDB-TSCRIPT-110912-586
Name
zgc:194101-201
Previous Names
  • ch211-217k17.13-001
  • zgc:194101-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052556 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052556|OTTDARG00000036897|ZDB-GENE-080723-68 zgc:194101|OTTDARP00000041310 CH211-217K17.13-001 LG_ BX323839.13 Danio rerio protein_coding KNOWN, 777 bp
ACACTGTATTTCTTCACTGAAGACAGTTGACAGCTCAAGG
CAGAATGGCTACTATGGTTTACCAAGTACAGGCTCCAGCA
TGTGGAGCCAGGCAGCATGTCAGAGGAGATCAAAACATGG
TGCCTGTTCCCTATCACGAGCCACTGGAAAGCACCAGCCA
CGCTGTTCTCCAGGTGGAAAAGCCAGTTTCTCCAGGTCCA
AAAAGCTTCTTTGTTAACATCTTTGATGGCTCAAAGGGAA
AGAAGATTACTGTAAAGATAAGGAGCACTGACACCATTGG
GAAACTCCAGAAGAAAGCAGAGAAGCTCAAGCCAGATTTT
GTGGGATGCGGGAATCTGACCTTTAATGGCAAACCAGTTC
AACTACAACAGAAGCTGTGTGATCTGCAGGTGGAGCCCGG
TGCTACATTCATCACCTACCAGAAGTGCCATGGAGGCTAA
AAAGACTTTTTTAAGCTCTTCTGTTTATTTTTTTTATGCT
TGCGTGTCTATTATGTACTATATGTCTTCATATAACCGTT
AGGTTCGATAAGTTTTGTTTACATTTGGTCACATTTTCAT
AAAAATTATCTTTTGGTTGACTATATAAATAATCAATATA
GTTTTGGGTTTTTGTTCATATATTATATTTGGGTTATAGA
AAATACCAGATTTTTATTTTTTTTACATAAAGTCTAAAAT
AATATTTAAAAAAAATTGTCAAGTTGTTTCTTTTTAATTG
TCTTGTAAAGAAATGTAGTCAAATTACACATTTGGAAAAT
AAACTTTAATAACCAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations