ZFIN ID: ZDB-TSCRIPT-110912-424
Transcript Name: znf1147-202
Previous Names: znf1147-001, dkey-179k24.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051629 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051629|OTTDARG00000036246|ZDB-GENE-080218-13 znf1147|OTTDARP00000040585 DKEY-179K24.8-001 LG_ CT956002.7 Danio rerio protein_coding NOVEL, 1579 bp
AAAAGACTTTTATTTTGGCGCGACGTGTGACGTCATAAGC
CTGCGCCGTTCCAGCGCTGTGATTCAACTGGAGAAAGGAA
AAAGTGTCCAAACACAGAGAAAAACTCCTGCTGAAGCGAC
TGATCTCCACACTGTTATAAAGATGGCGTTTATTAAAGAG
GAGAGTGAAGATGTGAAGATTGAAGAAACATTCACAGTCA
AACAGGAAGATCTGCAGGAACAAACAGACCGGATGGTGCT
GAAGGAAGAGACACATGGACAGAATGAAATAGATGAGAAA
TGGCAGTTTGAGAAACCACAAGAACTAACGACTGATGAAA
AACCCACACTGACTAAAAAGACTTCATCACACGGAAGACC
TCGGAAATCCAAATCTGGGTGTAATTTTAGCTGTAAACTG
TGTAGTAAGAGTTTCAGTCAAAAGTCAAACCTTGATGTTC
ACATGAGAGTTCACACAGGGGAGAAACCTTACACCTGCGA
ACAGTGTGGACAGAGTTTTAGTCAAAAACAATGCTTAAAA
ACTCACATGAGAATTCACACTGGAGAGAAGCCTTTCAGCT
GTAAGCAGTGTGGAAAGAGTTTTAGTCAAAAGCCAAACCT
TGATATTCACATGAGAGTTCACACAGGGGAGAAACCTTAC
ACCTGCGAACAGTGTGGAAAGAGTTTTAGTCAAAAACAAA
GCTTTAAATCCCACATGAGAATTCACACTGGAGAGAGGCC
GTACACATGCCAACAGTGTGGAAAAAGCTTCCGCCATGCA
AGAAACTTGGAAGTGCACATGAGAATTCACACTGGAGAGA
AGCCTTTCAGCTGTAAACAGTGTAGAAAGAGTTTAAGTAA
AAAGCTGAACCTGATTGCTCACATGAGAGTTCACACTAGG
GAGAAACCTTACACCTGCGAACAGTGTGGAAAAGAATTTA
GGTAAAAAACAAGACCTTTACATCCACATGAGTATTTACA
CTGGAGAGAAACCTTACATATGCACAGAGTGTGGTAAAAG
TTTCCCACATAAAAACACACTCAATCACCACATGAGAACT
CACACCGGAGAGAAGCCGTTTGCATGTGCTCAGTGTGGAA
AGAGCTTCACAACCAAATTTAGCCTCAAGAACCACATGAA
TGGTCACACTGGAACCATAGTGTTCACATGTGATCAGTGT
GGAAAGAGTCTCACACGGAAAGACACCATTAAGCAACACA
TGAAGATTCACTCAAGAAAGGATCGTTTTAGATGCAGTGA
GTGTGGAAAGGGCTTTAACTGTAAAAGAATCCTCAACACT
CACCTAAAGCTTCACAATGGAGAGCAGAGTCCTCAACATT
GAGGCCTTGTCCACACAAACACGGGTATATTCAAAACGGC
AGCTTTTTCATGTAGTTTGGCTGTTTATTCAAGTGAAGTT
TATTTATAAACTACTTTCGAGAGGATCACATGCTTAGCTA
AAACATGATTCACAAATTAGATCATCCTTTGTTATAAAGT
AGTGTCTCACAGTTAGTTACTTGAAGACAGACAAGTTAAC
ATCACTGCTGAGGAACTGCACTATTCATTGTCTTCAATAA
AGTCTTCACCCCGTAAGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf1147-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051629 (1),  Ensembl_Trans:ENSDART00000157986 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC159216 (1) 2007 nt
GenBank:BC154747 (1) 1579 nt
CITATIONS (2)