ZFIN ID: ZDB-TSCRIPT-110912-371
Transcript Name: znf1079-203
Previous Names: znf1079-001, dkeyp-35e5.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051430 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051430|OTTDARG00000036095|ZDB-GENE-110913-68 znf1079|OTTDARP00000040435 DKEYP-35E5.11-001 LG_ BX294383.7 Danio rerio protein_coding PUTATIVE, 1895 bp
AATAAAGTGTCCAAACAGAGAAAAACTCCTGCTGAAGCGA
CTGATCTCCACACTGTTATAAAGATGGCGTTTATTAAAGA
GGAGAGTGAAGATGTGAAGATTGAAGAAACATTCACAGTC
AAACAGGAAGATCAGCGGGAAAAAACAACCTGATGGTGCT
GAAAGAAGAGACTCATCATTGGAATAAAACGGAAGAGAAA
CAGTTTGAGAAACACCAAGAAACAACAACTGATGAAAAAC
CCACACTGACTGAAAAGACTTCATCATGCGGAGGACCTTG
GAAATCCAAATCTGCATGTAATTTTACTTGTCTTCAGTGT
GGAAACTGTTTCACTCGAAAACACAACCTTCAAGTCCACA
TGAGAGTTCACACTGGAGAAAAGCCTTACTCTTGCCCTCA
GTGTGGAAAGAGTTTTAAGCAAAATGGCTACCTTAAAGTC
CACATGAGAACTCACACTGGAGAGAGATGCTACACATGCC
AACAGTGTGGACAACGCTTCTATACTACAGGAAACTTTGC
ACAGCACATGAGAATTCACACTGGAGAGAGGCCGTACACA
TGCCTACAGTGTGGAAAAAGCCTCTATCAATCAGCAAACT
TGGCAGCGCACATGAGAATTCACACTGTGGAAAAGCCCTA
CTCTTGCATTCAGTGTGGAAAGAGTTTTAAGCAAAATAGT
ACCCTTGAAGCCCACATTAGAGCTCACAATGATGGCAGAA
TTTTTTCTTGCCAACAGTGTGGGAAAAGTTTTGCTCAAAA
GCAAGACCTTGAGATCCACATGAGGATTCACAGTGGAAAG
AAACCTTACACATGCACAGAGTGTGGTAAAAGTTTCAGAT
TTAAAAGCACACTCAAACAACACATGATAAGTCACACCAG
AGAGAAGCCATTTACATGTGCTCAGTGTGGAAGGAGCTTC
ACAACCAAATCTAGCCTCATGAACCACATGAATGTTCACA
CTGGAACCATAGTGTTCACATGTGATCAGTGTGGAAAGAG
TCTCACACGCAAAGACTCCATTAAGAACCACATGAAGACT
CATTCAGTAGAGCGTTTTAGTTGCTGTGAATGTGGAAAAA
GCTTTAAATCTGAAAGAAGCCTTAACACTCACATGAAGCT
TCACAATGGAGAGCAGAGTTCTCAAAATTGAGGCCTTGTC
CACCGGAGCTTGGGGCTCTCTCCCGGGACAGCATGCCAAA
CAAGTGTGAACTCTTGAATACATATCGTTACTGAAAATGA
AACCCTTTGAACACCTGAAGATTTAAACTCAATAACTGAG
GAGGGGTGAAGATTTTTTTGCAGTGTAGATCATGGGTCAC
AGCGCAACACCAGGTTGTAAGAGTTTCAACTTTATGATGA
ACCAATAACCATATTTTTGCACATTGCACACTTCAAATGG
TCAACAATGAGAAGAAAATTAGAAAGATTAGGGATGAGAA
ACTGTCCTACACCCTTAGATTGTGTTTTCAATCATTCATA
TTATTTGATTGTCATTCACGTGAACAAACACAGATTTGCC
TCCAGTTTTGGGCTTTTGTCTGCAATTTATAAAACTTGTT
GGCGAATTAAAGTCTGGCTGAACTTGTGCGGTGTGAACTC
GCCATAAGGCATTGACAGTGACTGACTGATGCAGACTCCC
TAAACCCTGTTCAGACTACACAATGCCATTTGCCAGTTGC
AATAGATCAGATTTGTGTCAGATTATTATGTGGTTTTGGG
TAACAAATTAAGACTTTGTTTTCAAAACACTAAACATTTA
TTTTGATGGACTGATTTAAGAAAGGAAGTTTTCTTCATGA
AGACAATTAAACTTTCTGTACACAACTGGTTACCTTTAAA
GATATGTTCATGTGAAAACTTCCACATTACTACAAATAAA
TTGGTGTATGGGAAA

znf1079 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA znf1079-201 (1)    Ensembl 1678
znf1079-203 1895
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf1079-203 Contained in:
[BAC] DKEYP-35E5 (1)

Genome Resources: Vega_Trans:OTTDART00000051430 (1),  Ensembl_Trans:ENSDART00000166513 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154363 (1) 1790 nt
CITATIONS (2)