ZFIN ID: ZDB-TSCRIPT-110912-370
Transcript Name: si:dkeyp-35e5.9-201
Previous Names: dkeyp-35e5.9-001, si:dkeyp-35e5.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051427 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051427|OTTDARG00000036092|ZDB-GENE-110913-107 si:dkeyp-35e5.9|OTTDARP00000040432 DKEYP-35E5.9-001 LG_ BX294383.7 Danio rerio protein_coding NOVEL, 1948 bp
AACAAAGCTTAACAAAAAGACTTTTATTTTGGCGTGTCGT
GTGACGTCATCAGGCGGCGCCGCTTCAGCGCTGTAATTCA
ACTGGAGAAAGGATAAAGTGTCCAAACACAGAGAAAAACT
CCTCCAGAATCGACGGATCTCCACACTGTTATAAAGATGG
CGTTTATTAAACAGGAGAGTGAAGATGTGAAAATTGAAGA
CACATTCAGAGTCAAACAGGAAGATCTGCAGGAACAAACA
GACCTGATGGTGCTGAAAGAAGAGACTCATCAATGGAATG
AAATGGAAGAAAAAAAACACCAAGAAATAACAACTGATGA
AAAACCCACACTCACTAAAAAGACTTCATCACGCGGAAGA
CCTCGGAAATCCAAATCTGGGTGTAATTTCAGCTGTAAAC
GGTGTAGAAAGAGTTTCAGTCAAAGGTCAAACCTTGATGT
TCACATGAGAGTTCACACAGGGGAGAAACCTTACACCTGC
AAACAGTGTGGAAAAAGCTTCTATACTATAGGAAACTTAA
CAGTGCACATGAGAATTCACACTGGAGAGAGGCCGTATGC
ATGCCAAAAGTGTGGGAAAAGCTTCTATACTACAGGAAAC
TTGGCAGCGCACATGAGAATTCACACTGGGGAAAAGCCTT
ACTCTTGCCTTCAGTGTGGAAAGAGTTATAAGCAAAATGG
CAACCTTGAAGTCCACATGAGAACTCACACTGGAGAGAGA
AGCTTTATTTGCACACAGTGTGGGAAAGGTTTTTCTCAAA
AACAAAACCTTACCATCCACATGAGGATTCACACTGGAGA
GAAACCTTACACATGCACAGAGTGTGGTAAAAGTTTCAGA
TGTAAAAACACACTCGATCACCACATGATAAGTCACACTG
GAGAGAAGCCGTTTGCATGTGCTCATTGTGGAAAGAGCTT
CACAACCAAAGCTAGGCTCATGAATCACACCAATGGTCAC
ACTGGAACCACATGTGATCATTGTGGAAAGAGTCTCACAT
GCAAAGACTCCATAAAGCAACACATGAAGATTCACTCAGG
CGAGCGTTTTCGATGCAGTGAGTGTGGAAAGGGCTTTAAA
CATAAAAGAAGCCTCATCAATCATATGAAGCTTCACAATA
GAGAGAAAAAATGAGGCCTTGTCAAGCGGAGCTTAAGGCT
CTCACCCGGGATAGCATGGAATAGCATCTCGGGACAAGTG
TGAACTCTTGAATACATCTCAAGTTACTGGAATGAAACCC
TTTGAACCTGAAGATTTAAACACAATAACTGAAGAGGGGT
AAAGATGTACCAGGTTGTGAGAGTTTCTACTTCTTCTTTG
CAAGAAAGCAAAATAACTCTATATGTGTTTTAAGTTATTA
TGAACTGAGAACCAAATTTGTGCACATTGCACACTGCAAT
CAAATGGTCGGCTCTGAAAAGAGAATTAGAAAGATTAGGG
AGGAGAAAATGTTTGGGGATATGCAGGGTAAACTCTCCTA
CACTCTTAGATTGTGTTTTTGATTATTCACATTGTTTGAT
TTTCACTCCCTTGAACAAACACCGATTTGCCTCCAATTTT
GGGCTTTTGTCTGCAGTTTCACAATACTTGTTGGTGAATA
AAAATCCACCTAAACTCGGCTGGTGTGAACTTGCAATGAC
AGTGAGAGACTGATGCAGACTCCATAAAGCCCTGATCAGA
CTACACAATGCCATTTGCCAATTACAACAGATCAGATTTG
TATAAGATTATGAGATTTTGACTTGATCAAATCTTGATGT
GTTGTGGGTAACAAATGAAGACTTTGGTTTCAGAACACTA
CACATTTATTTTGATGGACTGATTTTAGAAAATAAAAACG
TTTTCCTGTATTCAGACAATTAAACTTTCTGTAGACAACT
AGTTTCCCTCAAAGAAATGTTCATGTGAAAACTCCCACAT
AACTACAAATAAATTGGTGTATGGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-35e5.9-201 Contained in:
[BAC] DKEYP-35E5 (1)

Genome Resources: Vega_Trans:OTTDART00000051427 (1),  Ensembl_Trans:ENSDART00000168844 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC090744 (1) 1915 nt
GenBank:BC154747 (1) 1579 nt
CITATIONS (2)