ZFIN ID: ZDB-TSCRIPT-110912-37
Transcript Name: si:ch211-161m3.2-001
Previous Name: ch211-161m3.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051302 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051302|OTTDARG00000036001|ZDB-GENE-110914-154 si:ch211-161m3.2|OTTDARP00000040330 CH211-161M3.2-001 LG_ CR788316.12 Danio rerio protein_coding PUTATIVE, 667 bp
AGAGCAAGAAGCGACTGATTATAAAGATGGCGTTCATTAA
AGAGGAGAGCGAAGACGTGGAGATTGAGGAAACACTGAAC
GTCAAACAGGAAGAAACTGAAGAGCAAATAGACCTGAAGG
TGCTTAAAGTGGAGAGCAAAGTTCTTGATGAAGTGGAAGA
GAAATCAGAGTCTGAACAGACAGCAACTATAAATAACTTC
GTCTGCCCACAGTGTGGAAAGAGTTTCGCAAAGAAAAGAA
ACCTTAAGGAGCACATGAACATTCATAGTGGGAAGAAACC
TTTCAGCTGCAAACAGTGCGGACGCAGGTTTGCTCAACGA
GGAAACATCAAGAGGCACATGATGGTTCACACCGGAGAGA
AACCGTACGCGTGCAAACTGTGTGAGAAGAGCTTCACAAC
TGAACTAAACCTGAAGTATCACATCAGCAGTCACACCGGA
GAGAAACCGTTCATATGTGGCGATTGTGGAAAGACCTTTA
GATACAAAGCAACCTTTAAAAAACACATGGCGTCTCACTT
AAAGCAGAGCAGTTTTGAGTGTCATCAGTGTGGACGCAGT
TTCACAGACCAGGAAAGTCTTGGGAATCATGTCAAAACTC
ACACTGGAGAAAACCCATTGATGTGCGGTCACTGTGGAAA
GACTTTCTCCAACAAAACAAACCTCCA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-161m3.2-001 Contained in:
[BAC] CH211-161M3 (1)

Genome Resources: Vega_Trans:OTTDART00000051302 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT677020 (1) 710 nt
CITATIONS (1)