ZFIN ID: ZDB-TSCRIPT-110912-322
Transcript Name: zgc:174315-201
Previous Names: dkey-69c19.3-001, zgc:174315-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051210 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051210|OTTDARG00000035920|ZDB-GENE-080219-29 zgc:174315|OTTDARP00000040243 DKEY-69C19.3-001 LG_ CR387997.18 Danio rerio protein_coding KNOWN, 1428 bp
AGGCTGCGCCACTCCTGCGCTGGGATTCCACTGGAAAAAG
GATAAAGTGTCCAAACGCAGAGAAAAACTCCTGCTGAAGC
GACTGATCTCCACACTGTTATAAAGATGGCGTTTATTAAA
GAGGAGAGTGAAGATGTGAAGATTGTAGAAACAATTAGAG
TCAAACATGAAGATCTGCAGGAACAAACAGACCTGATGGT
GATGAAAAAAGAGACTCATCAATGGAATGAATTGGAGAAG
AAACAGCAGTTTGAGAAACCCCAAGAAATAACGACTGATG
AAAAACCCACACTGACTAAAAAGACTTCATCACACAGAAG
ACCTCGAAAATCCAAATCTGCATGTAATTTCACTTGTCGT
CAATGTGGAAACTGCTTCAGCCGAAAACGCACCCTTGAAG
TCCACATGAGAATTCACACTGGAGAGAGACCTTTTACCTG
TAAAGAGTGTGGGAAGAGTTACAGTCAAAAATCAAACTTT
AATGTTCACATGAGAGTTCACACTGGAGAAAGGCCGTACT
CATGCCAACAGTGTGGGAAAAGCTTCTATAATACAGGAAA
CCTTGCAGTGCACATGAGAATTCATACTGGGGAGAAGCCT
TACTCCTGCCATCAGTGTGGAAGGAGTTTTAACCAAAATG
GCACCCTTGAAATCCACATGAGAACTCACACTGGAGAGAA
ACCTTTCATATGCACAGAGTGTGGTGAAGGTTTCATATGT
CAAAGCGCACTCAATTATCACATGATAAGTCACAGCAGAG
AGAAGCCATTTCCATGTGATCAGTGTGGAAAGAGCTTCAT
ATGTAAAGCTAGCCTCATGAACCACATGAATGGTCACACT
GGAACCATAGTGATGTGATCAGTGTGGAGAGAGTCTCACA
TGTACAGACTCCAATAAGAAACACAAGATGATACACTAAG
GAGAGGATTGTTGTAGATGCAGTGAGTGTGGAAAGGACTT
TAATCATAAAAGAAGCCTCAACACTCACATGAAACTTCAC
AATGGAGAGCAGAGTCCTCAAAATTGAGACCTTAGGTATT
CATTACTTACAATTTAAGGCAACCAGTTTGTGTGTGTGTA
TTTATATGAAACATTTGAATTTTTCTTTTATTAGGTAGCC
TACTATGTTGGGTGTGCAGTCTGAAACAATTACAATGACA
TATCATAAAAAGGCTTCTTTATTTTACTCTTAGTATGTCT
ATACCTCATCTTTGCTATGACTTCACATGTAAATCACTTG
CGCTTCATCTGCGTCTGCTTACTGCACAAGCTGAACACTC
CCCTGCCCCCCAATTCCATGTAATGTAACCATTGTGAGGG
TGCAGGCGAGATGTCATTTTTTGAGAGACACTCAAATACA
TCACGTACACTGTGTGCAACATCTATAAGTCATGTAAATC
AAACTAAAATAAACATCATTTGATTATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174315-201 Contained in:
[BAC] DKEY-13E3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000051210 (1),  Ensembl_Trans:ENSDART00000111294 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155738 (1) 1427 nt
GenBank:CV481218 (1) 764 nt
CITATIONS (2)