ZFIN ID: ZDB-TSCRIPT-110912-245
Transcript Name: dnaja3b-201
Previous Names: dkey-30o19.2-001, ottdart00000052142, si:dkey-30o19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052142 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052142|OTTDARG00000010555|ZDB-GENE-040115-3 dnaja3b|OTTDARP00000047639 dnaja3b-001 LG_none AL845363.5,BX072555.15 Danio rerio protein_coding KNOWN, 2136 bp
CCGCAATGCAGTTGTACATGTCAGCTTCATGCGCATGCGC
AGTGCTTAACGAGTGATGTAAACATGGCAGCCTCCAGTGC
ACGCTGGCTGTCAGGCGCTTTTCCTGGACTTCACAGCAAC
TGTGCACTTTTAAAGTCTTCCAGAAATGGAGATGTTACTG
CTTTGAGGATATGCTGGAGTCGTAGTTATGTGACAGAGAA
GAGTTTAAGCTGCTGGAGGCACAGAGGGGGAGTGACATTG
AGGAGGATACCAGCATTGAGACCCCACAGTGTTTTTAGCT
CTCATTTCTTCCACACTTCTTCCGGCTTCCGTCAGCAGGA
CTTCTATGAAGTTTTGGGGGTTCCTCGGACAGCCTCTCAA
AAAGAGATTAAGAAAGCATACTACCAGTTGGCCAAGAAAT
ACCATCCAGACACCAACCCAGATGACCCTGATGCGAAAGA
GAAGTTTGCCAAACTGGCAGAAGCTTATGAGACCCTCAGT
GACGAGCTGAAGAGGAAGCAATATGACACATACGGCTCTG
CGGGTCCGAGTGCGAGTGGGACGGGGCAACAGCAGTACTG
GAGGGGCAGTGCCAACGTGGACCCAGAGGAACTGTTCAGG
AAGATCTTTGGAGAATTTGCAGGGGGGCGTGGCTTTGGTG
ACATCAACTCAATGTTTGATCAGACACCTGAATTTGTGAT
GGAGCTGTCGTTCATGCAGGCTGCCAAGGGTGTCAATAAA
GAAATTACCGTCAACATAGATGACGATTGTCCACGCTGTG
ATGGAAAAGCTTTTGAACCGGGAACTAAAGTGTCTCATTG
TCACTATTGCAATGGCACAGGAATGGAATCTATAAACACC
GGGCCCTTTATGATGCGCTCGGCTTGTAGACGGTGTAGCG
GACGGGGTTTTATCATCATTACGCCTTGCATAATGTGTCG
AGGATCTGGACAAACCAAACAGAAACAGACCGTCATGGTT
CCTGTGCCTGCAGGTATAGCAGATGGACAGACAGTGAAAG
TGCCCGTCGGAAAGAAGTACATGTACATCACATTCAGAGT
CCAGAAGAGTCCAGTGTTTCGTCGTGACGGTGCTGACATT
CACTCTGATGTAATGATTTCAATAGCGCAAGCCATTTTAG
GAGGAACCGCCAGAGCGCAGGGCCTGTACAGCACCATTGA
CATTGCGATTCCTCCAGGCATTCAGACAGACCATAAAATC
AAGCTGGAAGGAAAAGGCATCCCACGCATGAATAGTTTTG
GTTATGGAGATCATTATGTGTATATCAAAATCAAAATTCC
TAAGAAACTGACAAGAAGGCAGAAAATGCTGCTTTTAAGT
TTTGCTGAGGACGAAGAGGATGTGGAGGGAACGGTTAATG
GAGTAACCAAACCAGACCCTGGTAGATCTCAGGCCGGACA
AACCTCGACATCAGGACAGAGCAGAGAAGAAGAGCCAGAG
AAAGAGGAAGAGGGGTTTTTCTCTAAACTGAAGAAGATGT
TCACCTGAAGATCATAAAAGCAGCCATTAGTATAGATGTA
TGATATTAAAATCTATGGTTTTGTACTGTATGTTTAATAT
TTAAAGCCATTATAGAGTTCAGAATTGTACCATTTCACAT
ATATGACCACTAGTTTTGAACAGCTGACATTGGAATTTCT
GTTTCTCAAACTGCTTGCACAAGTTAAAAATATTTAACTA
TGGAGATGAAAATATTTATGTTCTTTTTGGAGGACAAAGA
AGTATAAAAGGAGTACTAGAAAGAAGTGTACTCGCCAAAC
TAAGGACGTTTCCAATCAGCAAGTCATGTCTGCTCACCCA
GATTAATTACCTTAAAAATGAAAGGATTGAAGCTTCCAGA
ATCCTTCACTAGAGTTTAGCTAAATTAACACTTGGCTATC
CTATGCTAGCTAAATGTGTGCTGTTTGGTGTATGATTGTT
GGAAATGTCTGAATAAATGTCACAAGAAATCAGTTTTGTT
ATATTATGTTAGCCTACGTATTATTATTAAAGCTCTCTTG
TTAGGGTTTGACTATTTCATGCTATGAAACTCTTTATTTA
TTGCTATATTAATTGAAGCTTAAGAGCTTTGCTTAGTCCA
ACACACAGCACATCTTTAGCTGTGACTAAATTAAAAATAA
AATTTTATTTGAAATC

dnaja3b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnaja3b-201 2136
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnaja3b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000052142 (1),  Ensembl_Trans:ENSDART00000157842 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC055555 (1) 2099 nt
GenBank:CO926975 (1) 921 nt
GenBank:EG585859 (1) 901 nt
GenBank:CK141760 (1) 830 nt
GenBank:CT618913 (1) 622 nt
CITATIONS (2)