Transcript

zgc:123278-201

ID
ZDB-TSCRIPT-110912-203
Name
zgc:123278-201
Previous Names
  • ch211-103e16.3-001
  • ottdart00000051980
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051980 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051980|OTTDARG00000036498|ZDB-GENE-051127-21 zgc:123278|OTTDARP00000040847 CH211-103E16.3-001 LG_ BX323801.8 Danio rerio protein_coding NOVEL, 1200 bp
ACTTTGTAAACTTCCTGTTGTGAAAAATACTGCAATATCT
CCTGGGACAAACAGCTTTTCTTCTCTGTCTATTATTTAAT
GTAAAGTCATGACCATCAGAACAATTCGTTATGTGAGGAG
GATGTTACCTAAGACATATGATCACAGGACAGAAGTTCTG
TCAGAGATATCTTTAGTTTTGTCTCATTATCAGCATCTTG
AACCAGTACTAGAGAAATTTGTCTTTAATGATGGCACAGC
AAAAAACTTGATCAATTTGACTGGAACCATTCAGGTGTTC
TATGAAAGAAAACAGTACAATATTCCAGTGACTTTGTGGC
TGAGAGAAAGTTATCCACGCACTGCCCCCATCTGCTATCT
GAAACCCACCTGTGAGATGGTTGTTGTGACCAGCAAATAC
GTCAACAGCAATGGAGAGATCATGATGCCTTACTTGGATG
AGTGGAAACATACCAAATGTGACCTGCACAGCCTAATTCA
GGTTATGATGGCAACATTTAGTGAGGTCCCTCCTCTGCGT
ATGCATCTTGACCAAGAGAAATCAACATCTGCTCACAAAA
TACACCTTGCTGATGATTTCTCACATGTGACGCTGAACAG
AGGGGATCATCTTCCTTTTTATGAACTTAATGAAACTATA
TGTTAGCTAGCTAAATGTCTTTACAATTTGTACATCTATA
AATTGTATGAAAACAATCATTTTACTGGCATGAATGCAAA
ATGTACATTTTTGTAAATACTCAAATTTTCTAAATACACA
AGTCACATGCTTGTAATGCAATGTTTTCATGTGATTCATG
CTCAGTTAAAATCCACATGGAATCAAAATCAAAACATTTT
TTCTAGCACACATTGTTCTTCTTAATGTTTGCAATTAATA
CATGCAAGTGAATCCACAGTTTTTATGGCTAACCTTTATT
CAAAATCTAACCAATTGTGTCCCTTCTGGAATGTCAGTCC
CTTTCTGATCAGTTAGCCATAGCTTACAAAGGTTAGCCAT
ATCCCTCCAATATTGAGTTTGCTGTGAAAAGTGAAAGATG
AGAGGTTGTGCACCAAAATTAAAATCGCATCCCTTTTCAA
TATAACATTTCAGTTGGAAACATGTCATCAAACTAAATTA
AAGTCTGCAGCAACTTTTGGTTCACAGCCTGTTTATTGTT
AAACATATTTTGACAATTGCAATAAATTTAAAAGAATATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations