Transcript

ottdart00000051881

ID
ZDB-TSCRIPT-110912-179
Name
ottdart00000051881
Previous Names
  • dkey-20j10.2-001
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051881 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051881|OTTDARG00000036441|ZDB-GENE-060526-250 si:dkey-20j10.2|no_translation DKEY-20J10.2-001 LG_ CU468920.7 Danio rerio processed_transcript NOVEL, 901 bp
AAAAGAGGGAAAGAAGGAAGGAGGAGAGGAAGCGTGATCA
CAGGATGCACCACAGGAGTAAACAAAAGGAAATTTCACTG
TTTGACGGAAGGAAAGTGTCTGACAGCACATGAAATGGAG
GGGCAGTGTAGAGGGATTCTAGGCTTAATTCCTTTATTAT
TCTGGGGTCACTATAGCGAAATGAACCACCCACTTTTCCA
GCACGTTTTACGCAGTGGATGCCCTTGGGAAGAGAGAAGA
GATGGATTCCTTCCCATCTCTGGGAATCATCCATACACAC
TCATTACAACAATACACTATGGACAATTTAGCCTACCCAT
TTTACTTGTACCGCATGTCTTTGGACTGTGGGGGAAACCA
GAGCACCCGGAGGAAACCCACGCGGATACAGGGAAAATAT
GCAAACACACAGAAACGCCAACTGACCCAGCCAAGGCTCG
AACCAGTGGCCTTCTTTCTGTGAGGCGAGAGCACTAACTT
CTGAGCCACTGCATATGCCAATTATATTTTCACTTAATTT
TTAAATTTTAAGTAAAATTCATTTGGGTTTTGGAAAATAT
TTTGGTTTAATTCAAATATTTGAGGTCTGACAACATGGAA
TATTTCATTTTGACTCGTTGTCATTTTCTGCATATTCTTA
AATGTAGACATTCTTATTCATTATCTTGAAAACCGAGTTG
TGTATGAAATATAATATAAGATTCAAATAAATAAAATACC
ATTTCACTTAAATCACTTGATGTAACTATTAATGACAAAT
CCAGTGAGCCAATACTAACTTTGAAGTGATTTTTTTATAT
GTCATTTGTGATCAGCATATATAAGTACATCCCTCACAAA
TCTATCTTTTAAATTCATATTTTTATTAGGAAGGTCTACA
ATATTATATTTGTCCATATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations