ZFIN ID: ZDB-TSCRIPT-110912-179
Transcript Name: ottdart00000051881
Previous Name: dkey-20j10.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051881 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051881|OTTDARG00000036441|ZDB-GENE-060526-250 si:dkey-20j10.2|no_translation DKEY-20J10.2-001 LG_ CU468920.7 Danio rerio processed_transcript NOVEL, 901 bp
AAAAGAGGGAAAGAAGGAAGGAGGAGAGGAAGCGTGATCA
CAGGATGCACCACAGGAGTAAACAAAAGGAAATTTCACTG
TTTGACGGAAGGAAAGTGTCTGACAGCACATGAAATGGAG
GGGCAGTGTAGAGGGATTCTAGGCTTAATTCCTTTATTAT
TCTGGGGTCACTATAGCGAAATGAACCACCCACTTTTCCA
GCACGTTTTACGCAGTGGATGCCCTTGGGAAGAGAGAAGA
GATGGATTCCTTCCCATCTCTGGGAATCATCCATACACAC
TCATTACAACAATACACTATGGACAATTTAGCCTACCCAT
TTTACTTGTACCGCATGTCTTTGGACTGTGGGGGAAACCA
GAGCACCCGGAGGAAACCCACGCGGATACAGGGAAAATAT
GCAAACACACAGAAACGCCAACTGACCCAGCCAAGGCTCG
AACCAGTGGCCTTCTTTCTGTGAGGCGAGAGCACTAACTT
CTGAGCCACTGCATATGCCAATTATATTTTCACTTAATTT
TTAAATTTTAAGTAAAATTCATTTGGGTTTTGGAAAATAT
TTTGGTTTAATTCAAATATTTGAGGTCTGACAACATGGAA
TATTTCATTTTGACTCGTTGTCATTTTCTGCATATTCTTA
AATGTAGACATTCTTATTCATTATCTTGAAAACCGAGTTG
TGTATGAAATATAATATAAGATTCAAATAAATAAAATACC
ATTTCACTTAAATCACTTGATGTAACTATTAATGACAAAT
CCAGTGAGCCAATACTAACTTTGAAGTGATTTTTTTATAT
GTCATTTGTGATCAGCATATATAAGTACATCCCTCACAAA
TCTATCTTTTAAATTCATATTTTTATTAGGAAGGTCTACA
ATATTATATTTGTCCATATAC

si:dkey-20j10.2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ottdart00000051881 901
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000051881 Contained in:
OTHER ottdart00000051881 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000051881 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK015733 (1) 897bp
    CITATIONS (1)