Transcript

si:ch211-162i8.2-201

ID
ZDB-TSCRIPT-110912-118
Name
si:ch211-162i8.2-201
Previous Names
  • ch211-162i8.2-001
  • si:ch211-162i8.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051608 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051608|OTTDARG00000036226|ZDB-GENE-110913-56 si:ch211-162i8.2|OTTDARP00000040569 CH211-162I8.2-001 LG_ BX649518.6 Danio rerio protein_coding PUTATIVE, 1806 bp
ACGTGACGTCATCAGGCGGCGCCGCTACAGCGCGGTGATT
CAACTGGAGAAAGGATAAAGTGTCCAAATACAGAGAAAAA
CTCCTGCTCAAGCGACTGATCTCCACACTGTTATAAAGAT
GGCGTTTATTAAAGAGGAGAGTGAAGATGTGAAGATTGAA
GAAACATTTACAGTCAAACAGGAAGATCTGCAGGAACAAA
CAGACCTGATAGTGCTGAAAGAAGAGACTCAATGCAATAA
AATGGAAGAGCAACACCAAGAAATAACAGCTGATGAAAAA
CCCACACTGACTGAAAAGACTTCATCACTCGGAAGACCTC
GGAAATCCAAAACTGAGTGTAATTTTAGCAGTAAACAGCG
TAGAAAGAGTTTCATTCAAAAGCGTAACCTTGGTGATCAC
ATGAGAGTTCACACTAGGGAGAAACCTTACACTTGCGAAC
AGTGTGGAAAGAGCTTTGGTAAAAAGAGAAGCTTAAAGAC
CCACATGAGAATTCACACTGGAGAGAGGCCGTACACATGC
CAACAGTGTGGAAAGAGTTTTAAGCAAATTGGCACCCTTA
AAGGCCACATGAGAATTCACACTGGAGAGAGGCCGTACAC
ATGCCAACAATGTGGAAAGAGTTTTAAGCAAAGTGCCACA
CTTAAAGGCCACATGAGAAGTCACACTGGAGAGAGGCCGT
ACACATGCCAACAGTGTGGACAAAGCTTCTATTATGCAGG
AAACTTTGCAGCGCACAAGAGAATTCACACTGGAGAAAAG
CCCTACACATGTCAACAGTGTGGAAAGAGTTTTAAGCAAA
GTGGCACCCTTAAAGGCCACATTAGAACTCACAATGGAGG
AAAAACACTGTGTGGTAAAAGTTTTGCTCAAAAACAAAAG
CTTGACACCGACATGATGATCCACACTGGAGAGAAACCCT
ACACATGCACAGAGTGTGGTAAAAGTTTCACATGTAAAAG
CTCACTCATTAACCACATGAAAACTCACACCAGAGAGAAG
CTGTTTGCATGTAATCAGTGTGAAAAGAGCTTCACATGTA
AAGCTAACCTCATGAACCACATGGATGGTCACTCTGGAAT
CATAGTGTTCATATGTGATCAGTGTGGAAAGAGTCTCACA
CGCAAAGACTACATTAAGCAACACATGAAGACTCACTCAA
GAGAGGATCGTTTTAGATGCAGTGAGTGTGGAAAGAGCTT
TAAACAAAAAATAAACCTCAGCGCTCACATGAAGCTTCAC
AATGCAGAGCAAAGTCCTCAACATTGAGACCTTCTCCACA
CAAACACGAGTATATTGAAAATGGCAGCTTTTTCATGTAG
TTTGGCTGTTCATTGACATGAAGTTTATTTATAAACTACT
TTCGAGAGGATCACATGCTTATTATTGTTCACGACTGGTC
CAGCATTAGCTAAAACATGATTCACCAATCAGATGATTCC
TGACTCCCTATAAATGACAAGAGATTCTTACCTCTTTTAT
CTTCATCGTTATCTTTTAGACTCCCTAAAGCCCTGTTCAG
ACTACACAATGCCATTTGTCAGTTACGACAGATGAGATTT
GTGTCAGATTATGAGATTTTGACTTGATCAAATCTTGATG
TGCTGTGGATAACAAATGAAGACTTTGGTTTCAAAACACT
ACACATATATTTTGATGGACTAATCTCAGAAAAGAAACAA
GTTTTCTTCATGAAGACAATTAAACTTAAAAGAAGAAATT
AAACTTTCAATAGACAACTGCTTGCCTTTAAATATACGTT
CATGTGAAACTCCAACATTACTACAAATAAATCATTGTAT
GGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations