ZFIN ID: ZDB-TSCRIPT-110912-118
Transcript Name: si:ch211-162i8.2-201
Previous Names: ch211-162i8.2-001, si:ch211-162i8.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051608 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051608|OTTDARG00000036226|ZDB-GENE-110913-56 si:ch211-162i8.2|OTTDARP00000040569 CH211-162I8.2-001 LG_ BX649518.6 Danio rerio protein_coding PUTATIVE, 1806 bp
ACGTGACGTCATCAGGCGGCGCCGCTACAGCGCGGTGATT
CAACTGGAGAAAGGATAAAGTGTCCAAATACAGAGAAAAA
CTCCTGCTCAAGCGACTGATCTCCACACTGTTATAAAGAT
GGCGTTTATTAAAGAGGAGAGTGAAGATGTGAAGATTGAA
GAAACATTTACAGTCAAACAGGAAGATCTGCAGGAACAAA
CAGACCTGATAGTGCTGAAAGAAGAGACTCAATGCAATAA
AATGGAAGAGCAACACCAAGAAATAACAGCTGATGAAAAA
CCCACACTGACTGAAAAGACTTCATCACTCGGAAGACCTC
GGAAATCCAAAACTGAGTGTAATTTTAGCAGTAAACAGCG
TAGAAAGAGTTTCATTCAAAAGCGTAACCTTGGTGATCAC
ATGAGAGTTCACACTAGGGAGAAACCTTACACTTGCGAAC
AGTGTGGAAAGAGCTTTGGTAAAAAGAGAAGCTTAAAGAC
CCACATGAGAATTCACACTGGAGAGAGGCCGTACACATGC
CAACAGTGTGGAAAGAGTTTTAAGCAAATTGGCACCCTTA
AAGGCCACATGAGAATTCACACTGGAGAGAGGCCGTACAC
ATGCCAACAATGTGGAAAGAGTTTTAAGCAAAGTGCCACA
CTTAAAGGCCACATGAGAAGTCACACTGGAGAGAGGCCGT
ACACATGCCAACAGTGTGGACAAAGCTTCTATTATGCAGG
AAACTTTGCAGCGCACAAGAGAATTCACACTGGAGAAAAG
CCCTACACATGTCAACAGTGTGGAAAGAGTTTTAAGCAAA
GTGGCACCCTTAAAGGCCACATTAGAACTCACAATGGAGG
AAAAACACTGTGTGGTAAAAGTTTTGCTCAAAAACAAAAG
CTTGACACCGACATGATGATCCACACTGGAGAGAAACCCT
ACACATGCACAGAGTGTGGTAAAAGTTTCACATGTAAAAG
CTCACTCATTAACCACATGAAAACTCACACCAGAGAGAAG
CTGTTTGCATGTAATCAGTGTGAAAAGAGCTTCACATGTA
AAGCTAACCTCATGAACCACATGGATGGTCACTCTGGAAT
CATAGTGTTCATATGTGATCAGTGTGGAAAGAGTCTCACA
CGCAAAGACTACATTAAGCAACACATGAAGACTCACTCAA
GAGAGGATCGTTTTAGATGCAGTGAGTGTGGAAAGAGCTT
TAAACAAAAAATAAACCTCAGCGCTCACATGAAGCTTCAC
AATGCAGAGCAAAGTCCTCAACATTGAGACCTTCTCCACA
CAAACACGAGTATATTGAAAATGGCAGCTTTTTCATGTAG
TTTGGCTGTTCATTGACATGAAGTTTATTTATAAACTACT
TTCGAGAGGATCACATGCTTATTATTGTTCACGACTGGTC
CAGCATTAGCTAAAACATGATTCACCAATCAGATGATTCC
TGACTCCCTATAAATGACAAGAGATTCTTACCTCTTTTAT
CTTCATCGTTATCTTTTAGACTCCCTAAAGCCCTGTTCAG
ACTACACAATGCCATTTGTCAGTTACGACAGATGAGATTT
GTGTCAGATTATGAGATTTTGACTTGATCAAATCTTGATG
TGCTGTGGATAACAAATGAAGACTTTGGTTTCAAAACACT
ACACATATATTTTGATGGACTAATCTCAGAAAAGAAACAA
GTTTTCTTCATGAAGACAATTAAACTTAAAAGAAGAAATT
AAACTTTCAATAGACAACTGCTTGCCTTTAAATATACGTT
CATGTGAAACTCCAACATTACTACAAATAAATCATTGTAT
GGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-162i8.2-201 Contained in:
[BAC] CH211-162I8 (1)

Genome Resources: Vega_Trans:OTTDART00000051608 (1),  Ensembl_Trans:ENSDART00000150282 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC152606 (1) 1817 nt
GenBank:BC154170 (1) 1800 nt
CITATIONS (2)