header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-894
Transcript Name: nphs1-202
Previous Names: nphs1-001, nphs1l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051126 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051126|OTTDARG00000035876|ZDB-GENE-051102-1 nphs1|OTTDARP00000040186 nphs1l-001 LG_none CU463790.10,CU656047.13 Danio rerio protein_coding KNOWN, 3381 bp
TCCCGTCTTCACAGCCGTACTTCCAGCTGGAGTCTGAGGA
GCCGTGGGTGGAAGGAGAGCAGTATACGGTGACCTGCATC
GCTCCTGATGCTAAACCTCCTGCAGAAATCACAATGTTTA
GAGATGGAGAGGAGCTGCTGGAAAGCGAATCGTATACAAT
GTCAGGCTCGCAGGATAAGCTTCAGAACACTCATGCTGAA
GTCACCATCAGGGCACGAAGCTCGGACGACACGCGACGCC
TGACGTGTCGAGCGAAAAACCCTGCTTCACCTCGAGCTCT
GGAGACTGGCATGACCATGAAGGTTTACTTTCCCCCACAG
GCTCCGATGATCATGGGATTGGAAAACGAAGAGGTCAAAG
CCGGCTCCTTTCTCAAAGTGGTATGCATGTCGTACGGGGG
AAACCCTTTAGCCACTCTGCATTGGACTAAGAATGGAGAA
GTCCTGTCCACAAGCTGGGATGTAGACTTTGTGTCCCGTC
GAGCAAGCAGCGTGTTAAAAATGGAGGTGAAGCCGGAGGA
CAACCATGCTGTTTTGCAGTGCCAGAGCATCAACCAAGTT
ACCCGTTCACCAATGTCCCTAACCCGCACTCTTACTGTCC
TCTTTGAACCAGCTGAGGTAACGTTACTGGGCTCCTTTGA
AGCTGTGGAAGGAGAGGAGATCAATCTGAGCTGCTCCACG
TCCTCCAGTAATCCACCCGTTCACATCCGCTGGTGGCTCG
GGTTCAAAGAGCTCAACAGAACAGAAGTTACCTTCGCCGA
GGGGGATAATGGTGGGATGATGACGGTGTCTAACCTGACG
CATAAAGTGTCTCGTGAGGACAACGGTCTTTCTCTGCAAT
GTGAGGCGTTCAACAAAGGCACGCGGTTCTCTAGCGTTCG
GGCTGCAGAACTCATTGTTTACTATCCTCCTCAGAAGGTG
TGGTTAGATGCTCCTCCACCAAATGTCTTTTTACACTCAG
GTTCAACTCTTCGCTTAGTCTGTTTCTCCAGTGGTGGAAA
TCCTACAGGTCAACTTACCTGGCTAAAGAACAATAAAGTC
GTGCTGACCGCATCGAAGCAGGTGTCTTCAGAGCGTGGTG
TGTCACGAGAGCTGCTTCTCATCCTTCATCCCAGTGACAA
TTTGGCCACCTACCGCTGTGACTCCTCCAACAAAGCCAAG
AAAGTCCTGTCCACCCAAACCAAATTCAGGGTTCTGTTTC
CTGCAGTGAGTGTGAAGATTGTGGCCAAGCAGAAGGAGCT
GCGCAGAGGTCAGACTCTGGATCTGGACTGTCTGGCCGGC
AGCAGCAATCCCACTGCAAATATCAGCTGGAGTCTGGGGC
CCGTCATACTGAAGGGAGTGGACCAGGCTCCGAAAAGGGC
TGAATTTGGTGGGATGTCCCGGACCAGTAAGCTGTCCCTG
ACTCTTGAATCCCATCACTGGCGGAAGCGAATCACCTGTC
AGGCCTTCAGTAATGTGCTTTCTGAGGGAGTCAACAATTT
CTACAGCCTCGATGTGCTCTTTCCTCCAGAGTTTTCAGAT
GAGCAGCCTGATGAAGTCCAGGTCATTGAGGACGAAACTG
CCACGCTTCCGGCCAAAGTCTCTGCAAACCCAGACGAAAT
CACCTGCGAGTGGATCTTCCAGGGCGAGAAGCTTGTGAAA
GAAAGAGATCCTCGTTATACCTTCAGTGACTGGACTCTTG
AGATCGTGAACGTGTCTCGGCGGGACGGGGGCGATTACAT
CATCGAGTGCTCCAACGCGGAGGGGAGCAATCGCACCAAA
CTCAGACTGGATGTACAATATTCCCCGACTGTTCGTATGA
AGTCTGACCCCGTGTTTGTGAACATAGGAGACACTGCAGA
CTTACTGTGTGTTGCTGATGCCAATCCCATCACCTCCAGT
ATGTTCTCATGGAAGTGGATGGGTGAAGGAGAAAGAGATG
AACTTGGAGAGGAAAGTGAAGATGACGGCACTGGCGTGTT
GACTATATATGAGGTGACTCGTGACCGTGCAGGTGTTTAC
CAGTGTACAGCAGACAACGGCATTTCACCTACTGGCAGTG
TGGAAGGACAGCTCATTGTACGCTTTGCTCCAGATCTTCA
GAAGGGGCCACAGTGGAGGAAAGTGGCCAGTCGAGGGGAT
GGCAGCAACGATGCTAATGTGGTGTGTCAGGCTCAAGGTG
TTCCTCGTGTTCAATTTAGATGGGCCAAAAATGGGTTCCC
GCTGGACCTCGGCAACCCCAGGTATGAGGAGACAACCGAG
TCGACAGGCACCATCCACACCAGCATCCTAACAGTCATAA
ATGTAAGCGCGGCTTTGGACTATGCCATATTCACCTGCAC
CGCTCACAACAGCATGGGCGAAGATTCTCTGGACATCCAG
CTCCTCAGCACCAACCACCCTGATCCGCCATCAGACCTGA
AGCTGCTCCGTGTCGACCAGACCTCCGTTACTCTGGAGTG
GATGCCTGGATTTGACGGTGGTTTGACACAGATCTTCCGT
GTCAGGTACCAGTGGGCAGGATCTGCAAGCTACATGTATG
TAGACGTGTTTCCTCCAACAGCTACTGTATATACAGTCAC
AGGCCTCAACCCTTCAACTATGTACAACTTCTCAGTCAAC
GCTCTCAATTCAATAGGAGAGAGCAGCTATGCAGACAACA
ACAAGATCCTGATGGTCACCACTGCTGATGCGAAGGAAGC
TGACGGCGGGGTCTCCACAGCGGACCAGGACTCGGCTCTT
GCAGGTGGTGGCCTTCCTGTCTATGTGGTGGTGATCCTGG
TTGTGGGCGGTGTTCTGTTCCTCCTGAACCCATTCATCTG
CTTTCTATTGGCCAGATGGAAAAGAAGGCGGAGCCTGAAA
GGGGACACCAGCAGCATTTCACAGGAGACCAAAAGTGAGG
AGCAGAGGTCCACAGCGAGCAGCTCGACCCGCTATGCGAG
CAGAGAGCTTATCAACGCCTCGGCACAGCGAACGCTCCTC
GTCGACAGCAGCTCAGAGCCTGACAGCAGCGTCTATGAGA
GCTACGGACGGCAGGAGAATCCTCATTATTACTACCCAAC
TGAGGCCTACAGTCCTGCCCTGTACGCTCACCCTGAAGGC
CCTGAGGATTACGATGGCAGACACGGCACAAGCCCTTTCA
CTCATGTCTATGAGGAGGTGAGAGGAATGTATGAGGACCT
GCAAGCCTGCTCACCGCTGCCCCCTGCTGCACACATTCAT
CCACAAGCGCCGTTTTCCACTTATTATGAGGGAAGAGCAT
ACAGTAAAGCTGATGTGGACGTAACAATTGGAGCTTATGA
TTCAATGGTGTACAGACGCAGAAGAGATACAGACCTGCCG
TTTGAGCTCAGAGGCGAGCTGGTTTAATAAGGGTTTATCT
GGCGTATATGGTCTGCTCAGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nphs1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051126 (1),  Ensembl_Trans:ENSDART00000150109 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ466904 (1) 3775 bp
GenBank:AL916524 (1) 424 bp
CITATIONS (2)