header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-829
Transcript Name: rhcgb-201
Previous Names: rhcgb-001, rhcgl2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050851 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050851|OTTDARG00000035703|ZDB-GENE-040426-2595 rhcgb|OTTDARP00000039930 rhcgl2-001 LG_ CU633616.5 Danio rerio protein_coding KNOWN, 1692 bp
GCAGCATCATCTGACATCATCAGCTCAAGCTGTAGACATG
GGCAACTGCTTCGGCTCCAGGGGCATCTGCGACCGGCCAA
AAAACACCAACATCAGACTCAGTTTACCCGCGGTGTGCTT
CGTCTGGCAGGTGTCCATGATCATACTTTTCGGAGTGTTT
GTGCGGTATAACGAGGAGGCAGACACTAACTGGGTTTACA
CGAAAAAGGAAAAAAATATAACAAGTGATATAGAGAACGA
CTTCTACTTCAGATATCCAAGTTTTCAGGATGTTCATGTC
ATGATCTTCGTGGGCTTTGGGTTCCTCATGACCTTCCTGA
AGCGCTACAGTTTTGGTGCTGTCGGATTCAACTTCCTGAT
CGCAGCTTTCGGCCTCCAGTGGGCTCTTCTGATGCAGGGC
TGGTTCAGTCCATTGGGCGATGATGGAAAGATCAAGATCG
GTATTGAGAAATTGATCAATGCAGATTTCTGTGTGGCCAG
TTGTCTAATCGCATACGGTGCGGTGCTGGGGAAGGTCAGT
CCGGTTCAGCTGCTGGTCATGACACTGTTTGGGATCACGC
TGTATGCTGTGGAGGAGTTCATCATCTTAAGTGTCCTCAA
CGCCAAAGACGCTGGCGGCTCTATGGTCATCCATACTTTT
GGAGCTTACTATGGTCTCTCCATCTCAAGGGTTTTATATC
GGCCCAATCTGAATAAAAGCAACCATATGAACGGGTCCGT
CTACCACTCGGACGTATTCGCCATGATCGGAACACTTTTC
CTGTGGATGTTTTGGCCGAGTTTTAACTCTGCTATTTGTA
ATCATGGAGACGGTCAGCACAGAGCCGCCATAAACACATA
CCTGGCCCTCGCCTCCACCGTCCTCACTACTGTGGCTATT
TCCAGCATGTTTGAGAAAACCGGAAAACTAGACATGGTGC
ACATTCAGAACTCTACCCTGGCGGGTGGCGTGGCCGTGGG
CACCGCAGCAGAGTTCATGCTGATGCCGTACGGCTCTTTG
ATCGTAGGCTTCTTCTGCGGTATCATCTCTACACTGGGAT
ACATCTACCTCACTCCCTTTTTGGAGGAGAGGCTGAAGAT
TCAGGACACCTGTGGCATTCATAACCTGCATGCCATGCCA
GGGGTCATTGGGGGAATTGTGGGCGCCATTTCAGCTGCTG
CCGCCAGCAAAGAGGTTTATGGAGACTTAGGTCTGGAAAA
CATCTTTTCCTTTGAGGGCTCAAATGTGACACGGTTGCCA
ACTGTCCAGGGTGGATACCAGGCAGCGGCACTGTGTGTGG
CCTTGTGTTTTGGCATCGGCGGAGGAACGTTTGTCGGGCT
GGTCCTAAAACTGCCCATCTGGGGTGATCCAGCTGATGAA
CACTGCTTCAATGATGAGATGTACTGGGAGGTTCCTGAGG
ATGAAGAGAGCATTATTCCTCCCGTCTTATCCTACAACAA
CCACATGATCCCCAACAACAAACATGAGGAGATGAGAGAG
ACCAACTTTGCAGAACAGCCGTGAAACTGAAGATCAGCGG
AGAGAGGTCAGAGACAACACAACTAACTACACCACCAGCC
AAAAACAACACCACTGGCCTAAAACAATACAACTGGCCTA
AAACAACACAACTGACTACACCGCCGGCCAAAAACAGCAC
AACTAAACTACTAAACCATCGGCCAAAAACAACACAATCA
GCTTCCACACCG

rhcgb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rhcgb-201 1692
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rhcgb-201 Contained in:
[Fosmid] CH1073-138P9 (1) (order this)

OTHER rhcgb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050851 (1)
  • Ensembl_Trans:ENSDART00000171200 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF398238 (1) 1981 bp
    GenBank:AB286865 (1) 1673 bp
    CITATIONS (2)