Transcript

etfb-201

ID
ZDB-TSCRIPT-110325-80
Name
etfb-201
Previous Names
  • etfb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000047803 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047803|OTTDARG00000033904|ZDB-GENE-040426-1931 etfb|OTTDARP00000037527 etfb-001 LG_none CU855686.17,CU693446.17 Danio rerio protein_coding KNOWN, 1388 bp
ACATTAAAGCCCGCCCTAAACGGTGTCACAGCAGCACTAC
TCCGGGTGGATTTTCCTACTGAACCGTCAGAGCAAAGATC
CACGATGAGCGCCCGAGTTCTGGTCGGAGTTAAACGGGTC
ATTGACTATGCAGTCAAGATCCGAGTCAAGCCTGACCACA
CTGGAGTGGTCACAGACGGTGTGAAGCACTCGATGAACCC
CTTCTGTGAGATCGCAGTGGAGGAGGCTGTCAAACTCAAG
GAGAAGAAGCTGATTAAGGAGGTTGTGGCCGTCAGCTGCG
GCCCTCAGCAGGTCCAGGAGACAATCCGGACGGCTCTGGC
CATGGGAGCAGACCGTGGCATTCATGTGGAAGTTTCCGGA
AAAGACTACGAGACTCTCGGCCCTCTACAGGTCTCCAAGA
TTTTAGCTGCTCTCGCTAAAAAGGAAGAAGCCAGTCTGAT
TATTCTGGGGAAACAGGCCATAGATGATGACTGCAATCAA
ACTGGACAGATGACTGCAGCTCTACTGGACTGGCCACAGG
GCACTTTTGCATCCGAGTTGGCTTTTGAAGCTGACAAGCT
GAAGGTGGTGAGAGAAATAGATGGTGGATTGGAGACCATT
AAGATCAAAATGCCCGCTGTAGTGACGGCTGATCTCCGGC
TCAACACTCCCAGATACGCCACACTGCCCAACATCATGAA
AGCGAAGAAGAAGAAGATTGCGATGGTGAAGCCAGCAGAT
CTGGGTGTAGACGTAAGCTCGCGGCTGGAGGTGCTAAAGG
TGGATGAACCTCCAACGAGACAAGCCGGAGTCAAAGTGGA
GACGGTGGAGGATCTGGTGGGAAAACTCAAAGAGGCTGGA
AGAGTATAGAAGATGTGGAGGAGCAACAGTGCAGACTCAT
ACTGACGGTCTTTCATCACTGGTGACGGAGCTCAATGTTG
ATCAAACTCTTGAGGCCAGTAACAAATCCAGACCCATGTA
GTTGATGTAGATGCTGCTCTTCTGTGTTTATGACTCTTTT
ACATTCGTCTGGATGCTGAGAGACACTCATCCACCCACAG
CCGTCCGTTCCAACCAATATTTCCGTGCATTGAATATAAG
AGTACACTTCTGGGGACACTTTCGAATGCACTAACAAGCC
ATCACATTTGCTGTTAATAATTAACTCAGAATCAAATCTG
CATTGACTTTATCTGTGCTGTGTCCCTGTCATTAAAAATC
GGTTATCAGTGGGGTTTGATTGAGCCTTATGGTTTATTGA
TGTTGATTTTTGTTGTGTTGTTTTGCGGACAGTGTCTCTC
AGCATGAAGAGAGAGTAAATCACGTTACCACAAGCGCCTC
TGAATGAGTCCTGATTGTACAGTATCGTTCGATGACAATA
AAAAGTCGTCTTTTTCATATGCATATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations