Transcript

selenos-201

ID
ZDB-TSCRIPT-110325-765
Name
selenos-201
Previous Names
  • sels-001
  • vimp-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050543 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050543|OTTDARG00000035509|ZDB-GENE-060804-1 vimp|OTTDARP00000039680 sels-001 LG_ CU856378.10 Danio rerio protein_coding KNOWN, 3587 bp
GGCTGCGGAAGTGAGTCAGTGTGGCGTTGCAGGTTAGCTC
GCGTACAGCAACAAGAAGAGAATAAACATGTGTTAGTTAT
TATATATTTTCAAAACAATATCGTAAAACAGCTCAAAGGT
GCTGTGAAGGATGGAGGCGGAGGACGGAGCGCGTGTCCGG
AATGAAGATGTTCCTCCGCAGAACCAGGATCTAAGTTTCC
TTCAACCGTCTGTCACTGCGTTCATGTCGGAGTATGGCTG
GTATCTGCTGTTCGGATGTGTTGGAGTGTATCTGCTCATC
CAGCATCTCCGCAAGAGCAGATCCTCCACACAAACACGCA
GCTCGTCTGGCTCAGCCGAGGCTCACGATGTGGGGTCAGT
GGTGAGGCGTCAGGAGGCTCTGGAGGCGTCCCGCAGGAGA
ATGCAGGAGGAGCAGGACGCCAGAGCAGCTGAGTTCAGGG
AGAAACAGCGCATGCTGGAGGAGGAGAAGAGGAGGCAGAA
GATCGAGATGTGGGACAGCATGCAGGAAGGAAAGAGTTAC
AAAGGGAGCGCTAAAGTTGCACAACAGAACACAGAAGAGG
CGGCTTCATCCAGCTCGCTGAGACCAAAGACAGAGAAGAA
ACCCCTGCGCAGCAGTGGCTACAGTCCTCTGTCAGGAGAC
GCTGGAGGCTCGTGCTCCTGGAGGCCCGGCCGCAGAGGCC
CGTCTGCTGGAGGATGAGGATAAACGCCCGTCAGACTCGT
CTCTGACGCTCCCACAGGAACACACACATCTATATCTGAA
TGAAGCTGTCAGCCTCATCACTGCACAATAACTCCCATAA
TACACACAATACAGAATCATTGCATTTCCAATCATGCATA
CTGTTACTTTTAGTCACACTTTACAATAAGGTTTCATAAC
TGAAGTATTTACTTACTTATAATGAACAATACTAGTACAG
CATTTGTTAATCATAGTTCAACATTACCTAATGCATTATT
CAAATCCTAAATCATCATCGTTAACACTATGAGCTAGCAT
TAAATGGCTTTATTTTCATGAACTAACATTAACAGAGCTA
AATACTGTAATATATTGTTTATGTAAGTAAATATTAACTA
ATATGTCCTATTGTAAACCATATTAACCTATTTATTTATA
TTACTCAACAAATATATGTATTCTTAAATGAATATACTGT
AGTGCGCAGCTTAAAACAAACATATTCAGTTAAATTAAAG
GTTAAATTACACAATAATGCTTAAAATAGACAATTATATA
CTTCTTTTATGCATAATAATCACATTTGCGATCAAAATGA
CGTCAATATCCACATTTGTTTTTCTTTTCTGCCTTGTAAA
TGATTTTTAAACAAGTGTTTTTCACTTTCTTTATGATTAT
TATGATGGTTATTATGCCAGTGTATGATTGACGGCTTCAG
ATGACGCCTCCTCACCAAAGGTATTATTTACTCCCGAGGC
GGCTGATGAGTTTCAGTAATGAAACGTGTTCCTCTTTTTT
TATTTCGTTGTTGCTTTTGCACTTAAATGCTGTGCTAAAT
ACAAATCTAGAGGGATTTAAAGGGGGCAGATCACTCAAAA
ATGAAAGTTTCCTTGTTTACTTACTCACCTACAGAACATG
CAAGATCGTAGGCACTTTCTTTCTTCTTCAGCAGAACATT
AAAGAAGCGTTTAAGCTGAATCTGACGTGATTCATATAAT
GAAAATAAATGGTGAGCAGTTTTTTTTTACATTAATAATA
AACGCATATCAATGAGTCCAAGTCAGTAGTCATGGCACAC
TGAGGTTTCTAGAAGTAAAATGATTGGTCTGTGTAAGACA
TTAAACATGATGCACAATATTATTACCTTAAATCCACAGC
CTGCTCAATGTAGTCCAATTGTAACTTCAATTACAAATAC
GGAAGAAAGCATGCTAGGATGGAGGAAATCAAAAGAGAAA
TATATTCATCATCAAAGGTGCCTAGACCAGGGGTCACCAA
CCCTGTTCCTGGAGAGCTGCCTTCCTGCAGAATTCAGTCC
CAACCCTGATCAAACACACCTGAACCAATTAATAGTACCT
AAAGCAGCACTTGATAATTACAAACAGGTGTGTTTGGTCA
GGGTTGCAACTGAAATGTGCAGGAAGGTAGATCTCCAGGA
ACAGGGTTGGTGACCCCTGGCCTAGACTACATTTACATAA
GAATAGAGATGCACTGATTTATTGGTTAAATTGTGTTTTT
GGATGGGTTTTTTTCCCGAAAAAGAAAAAAATGAGCGAAA
TAATGCACCAATAACAGGACTTTTTAAGCGTTCACAGCTA
GGTAAAGTAACTCAATCACTGTCAATTAAAATTTTACCTT
CATATAATGAACTATCATAATTAATTGTCATGGTTTAAGT
GACAGATGCATTTAAAAAGTCTTACTTTATTTAACAAGTA
CTAAATTGTTACGGCATTTTCATTTCATTTTTTATTTCAA
GTGCATCCAGAATTTTAGGTTTCCTCCCTGAATTTTCATT
TCAGCGCATCCCTGCAATCTTGATTTCCATTTTTGTGAAT
TGTGTCACACAAGAAATATCTGTTAATGAACAGTTTCTGT
ATTTTGTGATTCACAGGTGTGTGTTTTTGTGTTGATTTAC
AGTTGTGAACTGCATTATGAGACCTTAATCTCTGCTCTGT
TGAATTTTGATGATGATTTTTTTTTTAAAGTTGAAAATTT
TAAGTTCTATTGACATTTTAGTAGTTTGAAATAATATTTA
GAGAAATAAGATTGTAAAATAGCAGAAAATGTACTGGCGG
TTTATTATGAGGCTTTTGTTGTGTAATATACAACACCAAT
CCAGACAATATATCACTTTAAACTATGAAAAATGTTCACT
TTTTCCAACTTTTCAGTGTTATAAGTTATTGGAAGATCAA
GAGCCCATAATGCGATTCAAAAGCAGAAATAAATTAGGTA
AAATACAAACATGAATCACAAAAAACAGAAAACTGCTCAT
TTATGAATATTTTTAGAGTGCATATTAGTTTACAGTTATG
GCTCCATTTACACAAGTTCCCTAAAGAAAGTCACTTTCAG
GCCATTTAAACAGTTCTCAGCGCATATGCGACTGGAGTCT
GAATGTAGTCCTGTCACTTCAAGTGAGCGACCTATAATCT
TGGCTATGCAGTTTGTTGATTAAAGTGGGTTTAAAGAGTG
GGAATAAAGCTAATAACATTGTAAATAATGCTCAATTTCT
TCAACAAACTGATTATTTCACTTCACCTGACCTCAGTGTG
TCATTAGGAGCCACAACTATTGATCTGGACTTAATCTAAA
AAACCTGTCACCATTCACTGCCATTATATAAACCACCAAG
GACCCCTGATTCAGCTCAAATCTTCTACTGACATCTTGGA
TGAGGTGAGAGCCAGTAAATTAACTGGGTAATTTCATTTT
TGTGTGAGCTATTCCTTGAATACAAACGCAAAGTGCTATA
TTTCTATTGTTTGTGGTGTTTGTATTCTGTTGTGAAAGTA
GGAGTTACTGATGTGTCTTTAGTGTTGCGCGATCTGTTTT
CTGAAGCTTTTCTTCAGAAATATTCCTGCTTTGGAGATTC
TTTCAATTAAAAAGCATATTTGCCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations