Transcript

ca7-201

ID
ZDB-TSCRIPT-110325-729
Name
ca7-201
Previous Names
  • ca7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050372 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050372|OTTDARG00000035400|ZDB-GENE-040426-1786 ca7|OTTDARP00000039537 ca7-001 LG_ BX511136.4 Danio rerio protein_coding KNOWN, 1873 bp
GGCTTTAGAGGAGGCGGAGCCTGAGCGGATCAGCTCATCT
GTCAATCATCGCTCTTCCTTCACCTGTGTTACCGCTGTCA
GTATATTCAACCCGCCAACACAAACACACACGCACACACA
TTTCTCCACACACTCCTCCACACACTCCTCACTTGCGCTC
TTTCGACATCTCACACGCTGCTCAGAGAAGAGGAGCAATG
ACTGGCCATCACTGGGGATACGGAGAGGACAACGGTCCAT
CGGCATGGCACAAAGATTATCCCATAGCTGAGGGGAATCG
CCAGTCACCGATTGATATAGTCCCTTCAGAAGCTGTGTTT
GATGCCAAACTGTCTCCAATCTCACTGTCTTACAACAACT
GCACCTCTCTCAGCATATCTAACAATGGCCATTCAGTGGT
GGTGGAGTTTGTTGACACCGATGAGAGATCAGTGATTACA
GGAGGTCCTCTGGAAAATATGTACAGGCTTAAACAGTTTC
ACTTCCACTGGGGAAGCAAGGGTTGCTGTGGCTCCGAACA
TACAGTTGCTGGAAAAACCTTTGTTTCTGAGCTTCACCTG
GTTCACTGGAATGCCAATAAGTACAAGTCCTTTAGTGAGG
CTGCAGCTGCCCCTGATGGCTTGGCGGTGCTTGGCATCTT
TCTGGAAACCGGTGATGAGCACAGAGCTCTTCATCAAATA
ACAGATGCCTTGTATATGGTTAGATTCAAGGGCAGCCTTG
CTGAATTTAAGGGCTTTAACCCTAAGTGCCTCCTGCCAAA
CAGTCTTGAGTACTGGACATACCCGGGCTCTCTCACCACT
CCTCCTCTGTATGAGAGCGTCACGTGGATTGTGCTGAAAG
AGCCTATTTATGTGTCAGAGAAACAGATGGGAAAGTTTCG
CACGCTTCTGTTTAACGGTGAGGAGGAAGAAGACCGAAAT
CGAATGGAGAACAACTACAGACCACCACAACCACTGAAAG
GCAGGATGGTGCGAGCCTCTTTTAAATAGCCTGGTGCTTA
TTGATGAGCTGGAGCTTCAAAACCACCAAATATGATGAAC
TATATTCTTCAAAACACTGTTCCTTGATCACTTTTGAAGT
TCAGACGTATATTAAGGGTGTTGGGTTTGTTCTATCATGT
CACTGTCTCTTGAACGCTGCTTTAAGGTTTTGGGCAATGA
CCTTAAACACACAGCTTGACTGACATTGAGCTCTTTGAAT
CCGAGGCTCTCCATTTTTAGATCTCTTCTCATCCACCTTG
ATCAGGCTTGTGCAAACAGATCCTCGTTGTAGATTCAAAG
GGTCCAGGCTGTGGGTCTGGTAAGCCCACTGTCGCCTGCT
TCTTCACCGGTGTACACAGTAAGAATGGATCAGTAATCCA
GGAGTCTGAAATTGAACCCGTTCGTCTCCAGCTGGGGCTC
TTGTTAACTTTTGATAAGGCATGCGCGGTGACATTTAAGC
TCTTCATAGTAAGGTAGATGGTTGCACTCAGTTGACGCTT
GAAGTTGCATGATTACACAGCGTTATTTTGGATTTTGTTG
TGATTTTATAAAGTAAGTCGTCTTTGCAGACTGTAGTGGG
ACTTTGTTTCCTGGCAGTGAAACTTTATAAATGATTTTAC
AGTAATGTGTGGAGGTTGAAATGACTGATGGATCACGCTG
TGCACACTTTAAAAAACAAGTTCCTATTATTAATGTAATT
CCTAATGGAATCTCTGGCAGGGGAGTGACGGAAGCTCTCC
AACAGCTCAGAGCCGTATTTAGACTCAACTCCTGGAAAAC
ATCCAGCTCAGACGGCAGGGATTTTCTTTTGGATGTGTTT
GGGGATTTCATACGTTTTGTATTGTAATTAGGTATGTTAA
ATATGTACAAAATAAAACTATTTTAATAATCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations