Transcript

slc31a1-201

ID
ZDB-TSCRIPT-110325-662
Name
slc31a1-201
Previous Names
  • slc31a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050104 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050104|OTTDARG00000035242|ZDB-GENE-040415-3 slc31a1|OTTDARP00000039330 slc31a1-001 LG_ FP017233.5 Danio rerio protein_coding KNOWN, 4560 bp
AGTTCAGTTCGACACACTCTTGAACAGTCACTACAGAGCT
GCACTTTACACACTTGTTACGCCTGCATGTTGAAAGACAA
CTGAGAAAGAACAGACAGGAATTACCTGCACATTTCTGTG
GTTGAACAGAAAGACACTTCTTTGAGGAAGCAAGGAATTC
AGAGAGATTTGTTTTTGGCATCTCTGTACAGTAAGATGGA
TATGTCACATTCACATCACCATGTCGAGGAGACAACCATG
CCATCTCCTGCCTCAGACGATCATGGGGGTCATTTAACGA
CCTCTGGCAATGGCCACGGAGATCACATGATGATGATGCA
AATGACCTTCTACTTCGGCTACAAAAATGTGGAGCTGCTT
TTTGCTGGGCTGGTCATCAACACACCAGGAGAGATGGCCG
GCGCATGCATTGGCGTGTTCTTGTTAGCTGTGTTGTACGA
GGGCCTAAAGATCGGCCGGGAGGTCCTGTTGAGAAGGAAT
CAGGTGAACGTGCGCTACAACTCCATGCCTGTACCAGGAT
CTGATGGCACCGTACTCATGGAGACACACAAAACAGTCGG
CCAGCGAATGCTTAGTATGGCCCACTTCTTACAGACGCTT
CTTCACATCATCCAAGTGGTGGTCAGTTACTTCCTCATGC
TGGTGTTCATGACGTACAACGGTTACCTGTGCATCGCGGT
GGCGGCAGGAGCAGGCCTCGGCTATTTTCTGTTCAGCTGG
AAGAAGGCAGTAGTGGTGGATATTACAGAACACTGTCATT
AACCTCTCGTGTATAACCTCAAAAAGAAAAAAATTGCCCA
CTGTACAATCCCAGCATGCAACACAACAAGTGTAGAGCAC
CATATGATTTCATTCATCTTGGTAAATATTGGCCAAGTAG
CATTTTAAAGATTTATTTTGATTTGTTTACACAAATTAGC
ACCATATCTCATTTCCTGACAGCTCTGTTTTGGTTATTTA
ATTTTGGAAAATATGAGTGAGGAAGTTTTGTCTAATGTTA
ATGGTGTAGTTGTGTATATTAAGCAAAGCTAACAAAGAAC
TTTACATTGCTTAGCGGCACAAATTAATATGAAACATTTG
TAAACATTTTTGACCTCTTGCGACCAATTATGACAAATCA
ATGCGAAATTTCACCACATTTTTGCAGCCAAACTCGAGTC
ATTTTAATAGGAATCCGCATATCCGTTAATAAGGTTTCCA
AATTAACTGATTCGAAGTTAACTAATCTTAAAATCGTCAA
AATTTAAATATCATTTATTACCGTTTACTAAATTTTCCGC
CCATTGTCAATTTAGCAATTTAGCTATTTCATTATCGCAA
CATTTTATGAGGCTTCCAAATTTACTGATAACTAAATTAT
CATGACATTTGTAAAAATTAAAAAGCTCAAATTTGAAAAA
GACATCACATTTATCAACATTCATAATTTTTACAGACAAA
CTCTAGACATTTTAATGTACGCAATCATTTTTGCGCAAAT
GCAAAGCAGTTTGTAACTGTTTCCAAATTAAAAAAAATAG
TAGATTGGATTTTCCAGTCCTAAATTTTTTTAGTAAAATT
TATTTGAATAAGATTTCACTTAATTTTCAGAGACAAACTT
ATTTTAATGGTAATCCACACAATTTTGCAAAGTGCTAAAG
ATTTCCCCTAACATTTATTGCAACGACTTTGCCCAGGTTT
CCCAAAAAAATTAGTAAGTTTATTGGGTTCTTGGGAAATT
TCCAGTCTTTAAATGCAAATTTTGGGAAATAATCAAAGAC
AAACTCTAGTCACATTAATGTTCACAATCGTCAATTTTTG
TGCAAATGCGGTTACGCAGTTTTTCAAGTTGTAAATTGGC
CAATAGAACGTAGATTAGATTTTTGTAACTTTCCCACTCT
TGAAAATTTCAATTCAATACATTTGTGAAATATTTACATT
GCTGACTAAATTTTTGCAGACAAACAAATTTTTTTGGAAC
TCACTAAATATGATACAACTTAAAGCATTTTTTGACCTCT
TGCGACCAGTCATGACGAAAAACATTTCACCAAATTTTTG
CTGCCAAACTCTAGTCATTTTAATAGGAATCGACGCAACC
GCTAATATCGCAAGTGCACAATTATTGCACCAGTTGACAA
GGTTCTCCAAATTAACTGATTAGATAGTAATTGGATTTGC
GTGAAATTCCAATTCATTTATTACTATTCACAAAATTTTC
ACACCATCATCAGTTTTGAACAAATGTGAAAGATTTCTCT
ACACATTTATCACAAAGATTTACGAAGGTTTCCAATTTTC
ACTGACAAACCCGTTTTAATGTACGCGATCAGCATTTTTT
GCAAATGTGAAGGATTTTCCAACACCTTTCTCTAACAGTT
TCCAAAATGCAAAAGAAAGTAGAATATTATTCCCATAAAC
TTTCCGTCTTGAAAATTTCAATCCAATACATGTGTGAAAG
ATTTTTACTAAATTTTCGCAGACAAACTCCTTTAAATGGG
AATCCACAAAATTTCGTAAAGTGCTAATGACTTCCCTTAA
TATTTATCGCAACGGTTTACAAAGTTTCCTCGCAAACTAT
TAAGTTTATTGGTCTTGTTAAATTCCCAATTTTGAAAATT
TACAAATTTGCAAATATTGGTAAGAGCGAATTTTTTAAAG
GCAAACTTTTACAATCTTTTGCAATCAATTTTGGGCAAAT
ACGGTTACGTTTTTTTTGTTACATTTTCCTGTTGCAAATT
GGCCAATAGAAAGTAGACTGAATTCTTGTAACTTTCCCAG
TCTTGAAAATTTTCAGTCTAATTAATTTTAATAAGATTTC
ACTTAATTTTCGTAGACAAATTCCTTTTCATCGGAATCCA
GACACTTTCGTAAAGTTCTAATGATTTCCCTTAACATTTA
TTGTGACAATTTACAAGTAAAGTTTATTGAACTCCTGTGT
AATTCCCAATTTTGAAAATTTAATTGCAAATATTAAAAAA
GAGTGACTTCACTGAATTTGCAATTACAAACTCTAGTTAT
ATTAATGTTCACAATCACCAATTTTGAGCGAATGCGCTTA
CGTTTTTGTAAAATGTTCAAGTTGCACATGGGCAGATAGA
ACATAGATTGGATTTCTTTAACTTTCCCAGTCTTGAAAAT
TTAAATCCAATACATTTGTGACGTATTTACATTGCTAACT
GAATGTTTTGCGAACATTTTTATTTTTTCGTAACTCTAAT
TTTCATGAATTTGTCTGGCAATTTGGTAAAAAGAACAAAC
AAGCTGCGCATCCTTCATCTCTACACTTCAGCCTGCACAA
TTTAAAACATTAAGATCATAACCGTCACCTTATCAGTCTA
CCTCCAGATGGTACCGAGTCACGAGTGACCCTGTTCACTA
TAAACACATCTGTTCTACACATCTCATGGATTATTATGTT
TATGAAGGTGCTTTTGGGTGCAACAGAGCCTTACTAAACC
CCTTTGCCTTAAACAAGGGTACCGACACCCAGGAGGCCGA
CTCTGTAAACTCTAAAAGCCAAACTGGATCTGCTGGACCC
AGTAAACAAGCACTAGCGGCGGTGGGAAGGTGTTTAATAC
TTCTTTTTTTTTTTTTTTTTTGAGGTTGTTATGGCCAAGT
GTTTCAAATCAATGAAACGACAGTTAATAATCAGTGACCA
TTGTTTAGACTTAAACACTGGACTGAATGATGTTTGCACA
AGAAAGAGAGGTTTTGGGACTCTGTGTTTGCGGAGTTTGA
AGTCGAACTTTGCTCCCTTTGGAGTGATTTTAAATAAATA
TTGGGGGGGGAGATTGGAGAAAAATAAATTATATCTGATG
CCAGTGTCACCGATTTTTTTTTATAATTTATATTTGTAAC
ACTCTAGTATGACTGTGTGTGATATCAATGTGTTCTGGCA
ATCTTTATGTAGATCCTTTTACGTTATGACATCTTTTAAA
TGACAAAATGTGGCGCGTTTGCGATGTCGGGTAAATCATG
AGCCCTTTGGAACATTAAGGTCATCGCTCTGATTGTTACT
GGGTAGCAGAATGTGAATTTTATGTTCAATATATGCCCCT
TTGTTTGGGTGCGCCTTTTACATTCAGGACCCAATTAAAG
TGCCCAAAGAGTGTCTGAATTGCTTGTGAAAACAAAAGCC
GAGGCTTTCTTACGGAGAAAATCACATATTTTAAACCAGT
AAACATGTGGGTTTTAGTAGGAAGCCTATTTAAAATACCT
TTCCTTTATATTTTAGTTACAAGCAGAACAAAGAAATGTG
TGTAATCTCAGAGGTAAATATTCACATCATGTTGTTTTTG
TAGCAGGTGCCACTCTGTAGAACTGTATTTGAGGATCGGT
TCTCCGTTACGAGGCTTATTCGTATTGCAGATTGCTTTCG
ATATCAGAATAAGTTTGTGCTGTTTTATGTGTAGGAAAAA
AACTGCTAGCCCTTGCGTGGAAGGACTGAACCTCATGTCC
AGTGTTGTGGCCGTGTTAACATTTCTTAGTCTGTTTACAG
TTCAGTCACATCTGTAATGTCCGACATGTAAACCGTACTG
TAATCGTTAAAGAAAATGATGAATAAATGTTATGATTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations