ZFIN ID: ZDB-TSCRIPT-110325-657
Transcript Name: nme5-201
Previous Name: nme5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050088 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050088|OTTDARG00000035233|ZDB-GENE-040718-221 nme5|OTTDARP00000039318 nme5-001 LG_ FQ377590.3 Danio rerio protein_coding NOVEL, 969 bp
ACTGGCAGAAGAAGCGACATGATGGAGACTCCTGTGTGTG
TTATTGCTAAGTAAAACTGTTAATTGTGCTTCCAATGTGG
GTGATTTCATTTTTTTCACCTAATGGTTTGCAGCACATTA
ACTTGGCAATTAACGGAAGATTAAACTACCTTTTAAGAGT
TGGAAAAGCGTGTAAATTGACTGATGAAAGAAACGTTAAT
GGAGAACGACGATCCCCAGAAACTGATGCCCGAGCCTCGC
ATCTTTGTGGAGAGAACTTTGGCTTTAATCAAACCTGATG
CTATCCACAAAACCGACGAAATTGAGGATATTATTCTTCA
ATCTGGTTTTACGATTTTGCAGAAAAGACGGCTTCAGCTG
AGTCCAGAGCAATGCAGTGATTTCTACGCTGAGCATTATG
GGAAGCTGCATTTCCCCCATCTGACTGCCTTCATGAGCTC
AGGGCCGGTGGTGGCTCTAGCGCTGGCCCGAGACCAGGCC
ATTGCCACCTGGAAAGCCATAATGGGACCAGTCAGCAGCA
TAAAGGCCAGAGAGACGCATCCTGACTGTCTGAGAGCGAG
GTTTGGCACGTGTGACCTGAGGAATGCTGTCCACGGCAGT
GAAACCTTCTCTGCGGCTGAGAGGGAGATCAGGTTCATGT
TTCCCCATTCTGTGATTGAACCCATTCCTATGGGAGAAGC
TGCCAAAGATTACCTAAGTCGGTTCATCAACCCAACACTT
CTCGTTGGACTGACAGAGCTGTGCAAGATAAAGCCAGAGG
ACCCCTATACATGGCTTGCTGACTGGCTGATGAACAATAA
CCCTAACAAGCCCAAAGTATTGGATGGAGCAGCAGTAGAG
GAGGCAGCCTGATTTCCTTATTTTAAGCATTTGACCTAGA
ATGTGTTCATATTTTAAATTATTTTGGTATTTTCCCCCTC
ATACTGTTTGAAAATGCCTTGTTTAAAACATTAAAGAGTT
GTTTCTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nme5-201 Contained in:
[Fosmid] CH1073-115D16 (1), ZFOS-1809E12 (1)

Genome Resources: Vega_Trans:OTTDART00000050088 (1),  Ensembl_Trans:ENSDART00000060998 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC076282 (1) 988 nt
GenBank:BQ074993 (1) 448 nt
GenBank:EV564186 (1) 393 nt
CITATIONS (2)