Transcript

itga3a-201

ID
ZDB-TSCRIPT-110325-614
Name
itga3a-201
Previous Names
  • itga3a-001
  • ch211-250g22.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049841 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049841|OTTDARG00000035064|ZDB-GENE-090805-3 itga3a|OTTDARP00000039103 CH211-250G22.3-001 LG_ BX890565.9 Danio rerio protein_coding KNOWN, 3680 bp
GAATATGAACAATCAGTTCACAGCGTCTGAGAAAACCGCT
TCTGTTCAGACCCTCATATAATCTTTGTCCTGCACTCTCT
CTCTCTCTCTGCGTTTCGCCGAACAAAAACACCGCGGAGA
CCAACAGAAAAAATGATTGTATTTCACCGCAAAGGACTCC
GTTTAACCCTGGTGTTTGTTTTGAGCGCGGCTCGTCTCTG
TCAGGCGTTCAACTTGGATGTGAGCTTTGCAGTCGTCAAA
GAGGGAAAAACAGCAGGCAGTTTGTTCGGACTTTCTGTTG
CACTGCACGAGCAGGTCGTGAATGAGAAGAGACACATGCT
TCTGGTAGGAGCGCCAAAAGAGAAGGCGGAGTCTGGACTG
TCAGCCAATGAGACGGGAGATGTTTACGCCTGTCCGATCT
CTGCAGACTCCAAAGACTGTGCAAGACTGAACCTCATCAG
CTCAAATCCTGAAGACAAACCAGACCTTAAAAATTATGTG
ATAGATGGCATGTGGCTTGGTGTGTCCATAGTCAGTCAGA
GTCAACCAGGGGGCCGTGTTGTGGCCTGTGGCCATCGCTA
CATTCGTAACTTCACTAGCAACTTCCGCATGATTGGGAGA
TGTTATGTTCGGGGAAATGACCTGCAGCTCAACCTTAGTG
ATTATCAATGGCAGTCGTATGACGAGATTTGCGACCCCCG
AGAAGCCCAGAACAGTGAAGGCATGTGTCTGTTAGGGATG
TCTGCTGCCGTTACATTCAGTGAGATCTTCTTCGGTGCTC
CAGGATGCTTCAACTGGCAAGGAAATATATTTTCGAAGTG
GCACAACCCTGCGGATGAGTTTCATTTATTGAAAAGCAAG
CTTCCAGATTCTAGAAAAGGCAATATTTACATTGGTTACT
CAACGATTGTGGACCAAGATGTTCTAGTCAAAGGCAAAGA
CACAGTGGTAACAGGAGCACCGAGAGACGAAGCAAAAGGA
TCTGTGATGATGGCTGAAGTTTTGAAAAGCGGTGGCAGTG
GAGAAGTCAAAATAAAAGTCACTGTCACAGGAGAACAAGT
CGGGTCATATTTTGGCAATAGTGTTGCTGTTGTGGACCTT
AACAATGATGGTTGGAAGGATCTGATTGTTGGAGCCCCGT
TTTATTTTGACCGAAAAATGGACAAAGGTGGTGCAGTATA
CGTCTACATGAACCAAAACGGATCTTTTCGTAACAAATCT
GATGTGGTCCTAACTGGACCCAAGGACTCAGGTTTTGGCA
TGTCTGTTGTGGCCATTGGTGATGTTAACCAAGATGGCTT
CCAAGATTTTGCCGTTGGTGCTCCATATCATAGCACAGGC
AGAGTGTCTATATGGACAGGCAGCAAAACTGGCATTTCTC
AAGAACCTAGTCAGGTCATTGATGGAAAAGACATCCCAGG
TGGAGGATTCCAGACATTTGGCTACTCCATTAGTAGGGGC
CTGGATGTGGACAGAAATGGTTACCCAGATATAGCAGTTG
GATCATTAGATGACCGTGTGGTCTTGCTCAGATCACGTCC
TGTGATTCACTTGAAGAATACTTTCACAGTGACACCGATG
GTAATCAACCTTGAAGACTGTGTTGCCTGCATTGAAGCAA
AAGTCTGTTTCTCCTACACATACAGCACTGGCACTGCCAG
TTCCCAGAAGGCCGTGACTCTTCAATATACGGTGGAGGCC
GATCAGCAGTCGTCTAGGAGCCCCCGTGTTAGTTTCCTTG
ACAACAATAAGGGCAAATACACTGGCAAAATGTCTGTTAA
TCCGTCTGGAGATTGTCATTCTCTAAAACTCGAGCTGGCG
TCCAAAACAATCCAAGACAAAGTGTCTGCGATCATTTTCC
AGCTGAGCGTGTCTGTGGTGGATCCTCCTCCCTCAGGCGG
AAAGATGCTGGAGGATCTTAGTGCTTTTCCTGTGATCAGC
CAGCGAGACGCCTTGACCGGCAGAGCCGAGATTCACATTC
AGAAAGCCTGTGGCTTAGACAACAAATGCGAGAGCAACCT
TCAGATGACAGCTGCATTCACAGATGAGAAGAACACACCG
TTCCTCATGCAGGAAGATCACCAGATTTTCAACTACACCA
CCGACATAAAGAAGCTGAAGTTGTTAGTGAATGTCTCCAA
CGTACCATCAGAGGGCAGGAAAGCAGAAGACGCTTACAAT
GCTATTCTCAATATCACCATTCCAAGCTCACTCAGCTTCT
CCAGCCTGAATCCCAAGTTACCATCAACCCTGAATGGTGA
TCCATCTTCTGGGGGGTCTTATCTGTTGTGTACACTTGGT
GACCCCTTCAAAAGCAATCAGAGGGTGGAGATCGAGATCA
CGTTTGAAACATCAGGAATTTCAATAGACATGCAGGAGAT
TGAGACAGAGCTGCAGCTCTCAACGTTGAGTGATCAAAAT
GATCTACGGCCGCTGTCGAGGGTGCTGTTGGTGGAGTACA
TCCTACAGCCGCTTTTTAATTTAATCCCTTACTTCAGGGC
AGAATTCAGTGGCAATGTAGTGGGAGAGTCGGCCATGAAG
AGTACCAGTGATATCGGAAGCCCAGTGGAATTCAACATCT
CGGTGGACATTTCTGGAAAACCTTTGGGAAATCTGGGCTT
TCTGGAAGTGGTCTTTCAGTGGCCTTCTGCCGTGGCTAAT
GAGAAGTGGCTGCTTTACCTATCAGAGATTCAGATGACGG
GAACATCAGAGTCCTTCTGTGTCGCTAAAGGCATCGTAAA
CCCCCTTAATCTCACAGTGTCAGAGCGTAAGTCTAGGAGG
AGGAAAAGAGACGAGGTCTTGTCAGAGTCCAAACTGGCTA
TGTCGCAGAAAACCCGTCAGGGCCAAAACAAGCCTAGAGA
AGTCCTGAACTGCACCAAGGGCACTGCCCGCTGTCAGACC
TTCAGCTGCCCTTTGAGCGCAATGAAAACCTCCGCCATGC
TTACCGTCAGAGCGCGTGTTTGGAACAGCACCATGCTTGA
GGACTACAGAGCTAAAGGAGTGAGTGTGCAAGGCAGTGTC
ATGCTGACTCTAAAAACAGACAAAAAAAACATCAAGATGA
ACAATAACATCCGTGAGTTTACAGTAGAAATAGACCCCGC
AGTGGCTGAAGAACTACCGTATGAAGCTCCTTTGTGGATC
ATCATTGTGTCCGTTCTGTCAGGAGTGGTTATGCTGGGCG
TGATTGTTATTCTTCTGTGGAAGTGTGGTTTCTTCAAGAG
GGCCAACACCAGAGAGCTTTATGAGGCCAAGGCCCAGAAA
GCAGAAATGAAAACACAGCCATCAGAAAACGATCGCCTTA
CAGAGGAGGACTGAGATTCTGGCCTTTGCGGGCCTCTGAC
ACACAAATAGCAAAGTGGCTTTTTTACAAGGATCGACTAC
TTTCGAGCTATGCCAAAATACAAAGGCGTGAGGATTTGTA
AGAAGGAACAATACCAGGTAAACCAGGGCTTTTTGATTCT
GGACACCACGAACAACAGAAAACACTGGATCACGAGCTGG
ACAGAAAAGAAGCAGTACTACTGATGAAAAAAAAAAGCAC
TCGCAAACTGTCTCGCTTAGGCGGTGGAATGGACTATAAA
GCCGTCTGTGTCTGAATAAACGCAGATCTACTTGATTTGA
TTGGAACTTCATTTGGATATCAGATGAAATTGGACATGCT
CATTTAAAAATGTGGGACAAGAAATTATTGGAGGAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations