ZFIN ID: ZDB-TSCRIPT-110325-614
Transcript Name: itga3a-201
Previous Names: itga3a-001, ch211-250g22.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049841 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049841|OTTDARG00000035064|ZDB-GENE-090805-3 itga3a|OTTDARP00000039103 CH211-250G22.3-001 LG_ BX890565.9 Danio rerio protein_coding KNOWN, 3680 bp
GAATATGAACAATCAGTTCACAGCGTCTGAGAAAACCGCT
TCTGTTCAGACCCTCATATAATCTTTGTCCTGCACTCTCT
CTCTCTCTCTGCGTTTCGCCGAACAAAAACACCGCGGAGA
CCAACAGAAAAAATGATTGTATTTCACCGCAAAGGACTCC
GTTTAACCCTGGTGTTTGTTTTGAGCGCGGCTCGTCTCTG
TCAGGCGTTCAACTTGGATGTGAGCTTTGCAGTCGTCAAA
GAGGGAAAAACAGCAGGCAGTTTGTTCGGACTTTCTGTTG
CACTGCACGAGCAGGTCGTGAATGAGAAGAGACACATGCT
TCTGGTAGGAGCGCCAAAAGAGAAGGCGGAGTCTGGACTG
TCAGCCAATGAGACGGGAGATGTTTACGCCTGTCCGATCT
CTGCAGACTCCAAAGACTGTGCAAGACTGAACCTCATCAG
CTCAAATCCTGAAGACAAACCAGACCTTAAAAATTATGTG
ATAGATGGCATGTGGCTTGGTGTGTCCATAGTCAGTCAGA
GTCAACCAGGGGGCCGTGTTGTGGCCTGTGGCCATCGCTA
CATTCGTAACTTCACTAGCAACTTCCGCATGATTGGGAGA
TGTTATGTTCGGGGAAATGACCTGCAGCTCAACCTTAGTG
ATTATCAATGGCAGTCGTATGACGAGATTTGCGACCCCCG
AGAAGCCCAGAACAGTGAAGGCATGTGTCTGTTAGGGATG
TCTGCTGCCGTTACATTCAGTGAGATCTTCTTCGGTGCTC
CAGGATGCTTCAACTGGCAAGGAAATATATTTTCGAAGTG
GCACAACCCTGCGGATGAGTTTCATTTATTGAAAAGCAAG
CTTCCAGATTCTAGAAAAGGCAATATTTACATTGGTTACT
CAACGATTGTGGACCAAGATGTTCTAGTCAAAGGCAAAGA
CACAGTGGTAACAGGAGCACCGAGAGACGAAGCAAAAGGA
TCTGTGATGATGGCTGAAGTTTTGAAAAGCGGTGGCAGTG
GAGAAGTCAAAATAAAAGTCACTGTCACAGGAGAACAAGT
CGGGTCATATTTTGGCAATAGTGTTGCTGTTGTGGACCTT
AACAATGATGGTTGGAAGGATCTGATTGTTGGAGCCCCGT
TTTATTTTGACCGAAAAATGGACAAAGGTGGTGCAGTATA
CGTCTACATGAACCAAAACGGATCTTTTCGTAACAAATCT
GATGTGGTCCTAACTGGACCCAAGGACTCAGGTTTTGGCA
TGTCTGTTGTGGCCATTGGTGATGTTAACCAAGATGGCTT
CCAAGATTTTGCCGTTGGTGCTCCATATCATAGCACAGGC
AGAGTGTCTATATGGACAGGCAGCAAAACTGGCATTTCTC
AAGAACCTAGTCAGGTCATTGATGGAAAAGACATCCCAGG
TGGAGGATTCCAGACATTTGGCTACTCCATTAGTAGGGGC
CTGGATGTGGACAGAAATGGTTACCCAGATATAGCAGTTG
GATCATTAGATGACCGTGTGGTCTTGCTCAGATCACGTCC
TGTGATTCACTTGAAGAATACTTTCACAGTGACACCGATG
GTAATCAACCTTGAAGACTGTGTTGCCTGCATTGAAGCAA
AAGTCTGTTTCTCCTACACATACAGCACTGGCACTGCCAG
TTCCCAGAAGGCCGTGACTCTTCAATATACGGTGGAGGCC
GATCAGCAGTCGTCTAGGAGCCCCCGTGTTAGTTTCCTTG
ACAACAATAAGGGCAAATACACTGGCAAAATGTCTGTTAA
TCCGTCTGGAGATTGTCATTCTCTAAAACTCGAGCTGGCG
TCCAAAACAATCCAAGACAAAGTGTCTGCGATCATTTTCC
AGCTGAGCGTGTCTGTGGTGGATCCTCCTCCCTCAGGCGG
AAAGATGCTGGAGGATCTTAGTGCTTTTCCTGTGATCAGC
CAGCGAGACGCCTTGACCGGCAGAGCCGAGATTCACATTC
AGAAAGCCTGTGGCTTAGACAACAAATGCGAGAGCAACCT
TCAGATGACAGCTGCATTCACAGATGAGAAGAACACACCG
TTCCTCATGCAGGAAGATCACCAGATTTTCAACTACACCA
CCGACATAAAGAAGCTGAAGTTGTTAGTGAATGTCTCCAA
CGTACCATCAGAGGGCAGGAAAGCAGAAGACGCTTACAAT
GCTATTCTCAATATCACCATTCCAAGCTCACTCAGCTTCT
CCAGCCTGAATCCCAAGTTACCATCAACCCTGAATGGTGA
TCCATCTTCTGGGGGGTCTTATCTGTTGTGTACACTTGGT
GACCCCTTCAAAAGCAATCAGAGGGTGGAGATCGAGATCA
CGTTTGAAACATCAGGAATTTCAATAGACATGCAGGAGAT
TGAGACAGAGCTGCAGCTCTCAACGTTGAGTGATCAAAAT
GATCTACGGCCGCTGTCGAGGGTGCTGTTGGTGGAGTACA
TCCTACAGCCGCTTTTTAATTTAATCCCTTACTTCAGGGC
AGAATTCAGTGGCAATGTAGTGGGAGAGTCGGCCATGAAG
AGTACCAGTGATATCGGAAGCCCAGTGGAATTCAACATCT
CGGTGGACATTTCTGGAAAACCTTTGGGAAATCTGGGCTT
TCTGGAAGTGGTCTTTCAGTGGCCTTCTGCCGTGGCTAAT
GAGAAGTGGCTGCTTTACCTATCAGAGATTCAGATGACGG
GAACATCAGAGTCCTTCTGTGTCGCTAAAGGCATCGTAAA
CCCCCTTAATCTCACAGTGTCAGAGCGTAAGTCTAGGAGG
AGGAAAAGAGACGAGGTCTTGTCAGAGTCCAAACTGGCTA
TGTCGCAGAAAACCCGTCAGGGCCAAAACAAGCCTAGAGA
AGTCCTGAACTGCACCAAGGGCACTGCCCGCTGTCAGACC
TTCAGCTGCCCTTTGAGCGCAATGAAAACCTCCGCCATGC
TTACCGTCAGAGCGCGTGTTTGGAACAGCACCATGCTTGA
GGACTACAGAGCTAAAGGAGTGAGTGTGCAAGGCAGTGTC
ATGCTGACTCTAAAAACAGACAAAAAAAACATCAAGATGA
ACAATAACATCCGTGAGTTTACAGTAGAAATAGACCCCGC
AGTGGCTGAAGAACTACCGTATGAAGCTCCTTTGTGGATC
ATCATTGTGTCCGTTCTGTCAGGAGTGGTTATGCTGGGCG
TGATTGTTATTCTTCTGTGGAAGTGTGGTTTCTTCAAGAG
GGCCAACACCAGAGAGCTTTATGAGGCCAAGGCCCAGAAA
GCAGAAATGAAAACACAGCCATCAGAAAACGATCGCCTTA
CAGAGGAGGACTGAGATTCTGGCCTTTGCGGGCCTCTGAC
ACACAAATAGCAAAGTGGCTTTTTTACAAGGATCGACTAC
TTTCGAGCTATGCCAAAATACAAAGGCGTGAGGATTTGTA
AGAAGGAACAATACCAGGTAAACCAGGGCTTTTTGATTCT
GGACACCACGAACAACAGAAAACACTGGATCACGAGCTGG
ACAGAAAAGAAGCAGTACTACTGATGAAAAAAAAAAGCAC
TCGCAAACTGTCTCGCTTAGGCGGTGGAATGGACTATAAA
GCCGTCTGTGTCTGAATAAACGCAGATCTACTTGATTTGA
TTGGAACTTCATTTGGATATCAGATGAAATTGGACATGCT
CATTTAAAAATGTGGGACAAGAAATTATTGGAGGAGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itga3a-201 Contained in:
[BAC] CH211-250G22 (1)

Genome Resources: Vega_Trans:OTTDART00000049841 (1),  Ensembl_Trans:ENSDART00000055263 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC067690 (1) 1345 nt
GenBank:EV757838 (1) 933 nt
GenBank:CK015888 (1) 888 nt
GenBank:CD758723 (1) 812 nt
GenBank:CF347171 (1) 806 nt
GenBank:DT060832 (1) 741 nt
GenBank:EB768585 (1) 609 nt
GenBank:EB965695 (1) 495 nt
GenBank:EB774244 (1) 351 nt
CITATIONS (2)