Transcript

ahnak-201

ID
ZDB-TSCRIPT-110325-564
Name
ahnak-201
Previous Names
  • ahnak-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049596 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049596|OTTDARG00000034927|ZDB-GENE-030131-8719 ahnak|OTTDARP00000038908 ahnak-001 LG_ BX571940.12 Danio rerio protein_coding KNOWN, 20569 bp
GCCATTCTCCATAGCCCGGAGTTACAGGCACACTGAGAGA
AGAGAGAAAAATAAACAGCACGAAAGTGAGAAGAAGAGAG
AGAAAGAGAGCGAGCAAGTGATATAAAGTAACTTAAACAA
GACAAATATAAAGAGAGGTTCCACGCCTCGAGAACGAACG
AGAGTACACGAATAAGTTGAGTTCAGAAAGCGTGGTGGAA
AACTTCTGGGCTGTGGCAGAAAGCTGTGGACCGCGGAGGA
TGCCAGAGCAAAGGCGTTGAAGGATTCAGGGAACGAACAA
GGGCTGACACGGTCCACACTAGGGGACAGGTGAAGAAGCA
ACACATTCAAAGATGGATGATGACCAGGACACAAGGGAAG
TACTTTTCCCACAGTGGATGGGCGCTGATAAGCATGGGCT
CACCATTGAACAGAAAGGCCAAGGAGAGATTTTTGTCAAA
GAGGTGAAAGATGAGTCACCTGCTGCTCACACTGGAAAAG
TTCATGAAGGTGACCAAATTGTGGGGGCCACCATTTACTT
TGACAACATGAGTTCAGAAGAAACAGCTGAGCTATTGAAG
ACTCTAAACCGACATAAAGTTGGATTAAAACTACAAAACA
AGGGTGGAGACAAATCACCTTGCCGCTCTCCAATGGGAAC
GTTGTCATGGGAAGGACGTGGAAGTTTCGGAGGATCAAGT
TCAGACATTCTCCTGAGTGGGGATGATGAAGACTACAAGA
GAATCTATAGCAAGAAGATTAAACCTAGACTGAAGTCTGA
GGACCTTGCTGAGGGTGTTGATGTGCGCACAGAACGCCAC
AGCAGCACAAGCAGTGATGGTTGCACCATCACTACAATCA
CTCGACGAATAACTACCTACACAGTTGATATGCCTGGGGG
CACTAGTCAGCAGATTGATCCCTCAAGTCCTGAGTTCAAA
ATTCAGCTCTTGCAGCATGAGCAGGAAGGGGGTGATTCTT
CACAAATAGGATTACCACACAGCAGCCTTGTTAGCAGTGA
ACACGGGGGTAAAAATTTAGGGGACATATCTTTTGGTGGG
CCCCATGTCACTGGCTCGTCTGTGAAGCACTGTAGCACAG
GATCTATCAGAGCAACAAGTGAATTAGATGGCAGTGGGAG
AGAGATTACAATTAATGTGTCAGACACTGGACTTTCAGGG
GGAAGAGGACAAAGATTTACAGAACATTTTGTAGGGACTG
AAACTTCTCTAGAAGGTAATTTCTCTGGTAGAGTAACCAC
AGGGTTAGAAAAACAAGTGGGAAATATTTCTTCACCAGTA
GAAGCTAGTTTTAAAGCTTTAAGTACGAAAGGAGGAACAG
TAAAGGGCTCTGTTCTGGAAACGCATGGTTCAGGCTTTTC
CATAATTGGAGGATCTAAGGGCAGTATTGGCAGAGAATCT
TCTTCTGAAGTACTTAAGGATGGATCTGATGATCTAACCA
AGCTGTCCAAGTTTAGCATAGATGTTCAGAGACCCAAAGT
AAACATCAAACGTTCAGAAGCCGATATCAGCCAGGGTTCT
GATTTTGCTATTCCAGACATGGACAGTAAAGCCAAGTTAC
CAAAAGTTGAAACTAGTGGATCAGTTGTTCACTCTAAGGA
AATTGGTGGTGAATTCAAGCTTCCAAATGTGAAAGGCTCA
AAACAGTTTACTGTGGAAAGTCCAAATGTAGAAGCAAATT
TTAACAATCAAAATCTTAAAGATGTTAGTCAGAGAGGTTT
TAGCTTAACTGGAAATCAGGATTTACCACATCCATCATTT
AGAATGAAAGGCACTAATTTAGAGGACTCCAATTTGGGTG
CTGATATGGACATCAGTGGTCCAGAGTTTCAGGTTCAAAG
ATGTGAGATTAAAGTCAAAGATACCCAGTTTGATGTGCCT
TCAGTCACTGGCCAGGGAATTTCAATTTCAGATGTAGACT
TAACTCTGAAAGAACAAAAAAGAGGTGTTAATGTGTGTGT
TCAAAATATTGAAAGCAATGTTATGACACCAAAAGTTGAA
ATCAAAGGACAAAGTCTTAAAGGTGTAGAGGATGGCTTTA
TGATGAAGGGTCCCAATATTGATGCAAATGCTGCAAATGC
CAAAATAGAGATTAAAACCCCAAACATTGATATGAAGACT
CAAGAGTTTAATATTGAAGGACCTGAAAGAAAATACAAAG
TTTCAAATGTCAAGGTACCATCAATTTCCGGTACATCTGT
GCAAAATGTAAACATCACAGGACCTGCTGGGACAGCAGGG
GACTTCAGCATTTCTGCTCCAAAAACGGAAGGAGATATTA
AAGCACCATCCATTGAAATCAAAGGTCCAAAATTGATGGG
TTCTAATGTAGACTTAAATCTTCCTAAAGCAGAAATAGAA
AACAAACAAACAGGCGTAGAAATTAGGCTTCCCTCAAAGC
CTGATATTGAGGGAGCTGATGGAAAAATCACATACCCAGA
ATTCAAGAAGACATCAATCACTGGGCCGAATATTTCTATG
CCAGAAGTCAACTTGAACATCAAAGGTCAGAAATTGAAAG
GCAGTGTTGAAACATCTGTTCCAAAAGTGGAAGGACATAT
TAAAGAACCAGAAGTAGCAGTTGAAAGACAAGATGGTCCT
GAGAGGGGTTTTGGGATGCCAATATTTGGGTTGAAGGGGC
AAAAAGTGGAGGGTCCAGGTTTTGATGTAAAAATCTCCAA
AGCTGATGTTGAACTTAAGGAATCAAATTTAAACATTAAA
GCTTCAAAGCTTGACACTGAGAGATCTGATGGAACAATCA
AAGACAATAAAATCGTTATGCCTTCTGTTTCTGGGCCAAC
GATTTATATGCCGGGTGCTGATTTTAACCTGACAGGCTCT
AAACTAAAAGGAGATGTTGATGCGTCCCTTCCAAAAATTG
AAGGAGATATTAAAGCTTATGATATGGACTATAAAGCTCC
AAAACATAACATTGACAGACCTGAGGGGAAACTTAAGAGC
CCTGAATTCAATATGCCATCAGTATCTGGGCCAAATATTT
CTATGCCAGATGTTGACTTAAATCTTAATGGTTCGAAACT
GAAAGCTGATGTTGATGTTGATGTTTCTGTTTCGAAAGTG
AAAGGAGATATTAAGGTACCTGATGTGGACATTAAACCTC
CAAAAGTTGACATTAAGGTACCTGAGGTGGAAATCAAGGG
CCCAAAATTCAATATGCCATCAATATCAGACTCAAATAAT
TCCATGCCAAATGTTGATTTTAACCTCAAAGGCCAGAAGA
TGAAGAGTGATGTTGATGTGTCTGTTCTAAAAGTGAAAGG
AGATCTAAAGGACCCTGGTGTGAACATTAAAGCTCCAAAC
TTTGAAATTGAGGGATCTGATGGGAAAATCAAGGACTCTA
AATTGAGTATGTCATCAATATCTGGCCCAAATATTTCCAT
GCCAGATGTTGACTTTAACCTCAAAGAATCGAAACTGAAA
GGTGATGTTGATGTTTCTGTTCCAAAAGTGGAAGGAGATA
TTAAAGCACCAAAAATTGAACATGAAGGCCCAGACCTTGA
GGGTGGTTTTAAGATGCCAAAGATCAATATACCAAAATTC
GGATCCAAGGGCCCAAAAATGGAAGGACCAGACATGGATG
TAAAATTCCCTAAAACTGATATCGATATTAAAGCACCTGA
TGTGGACGTTAAAGCTGCACAGCTTGACATTGAGGGACCT
GAGGGAAAAGTCAAGGGCTCCAAGTTCAAAATGCCTTTCT
CCGGACCAACAATTTCTATGCCAGATGTTGATTTCAACTT
GAAAGGACGGAAAATGAAAGGTGATGTTGATGTGTCTATT
CCAAAAGTGGAAGGAGATGTAAAGGTCCCTGGTGTGGAAA
TTAAAGGTCCAAGAGTGGACATTGAGGGACCTGAGGGGAA
AATCAAGGGCTCTAAATTCAGTATGCCATCAATATCTGTC
CCGAATGTTTCCATGCCAGATGTCGACTTTAACCTTAAAG
GTTCAAAACTGAAAGGTGATGTTAATGTTTCTGTTCCAAA
AATGGAAGGAGATGTTAAAGCACCAAAGGTCGAACTTGAA
GGCCCAGACATTGAGGGTCCTGAGGGTGGTTTCAAGATGC
CAAACATCAAAATGCCAAAATTCGGATCCAAGGGTCCAAA
AGTGGAAAAACCGGACATAGATGTGAAAATCCCTAAAACT
GATATTGATATTAAAGCACCTGATGTGGACATTAAGGCTC
CAGAGCTTGACATTGAGGGACCTGAGGGAAAAGTCAAGGG
CTCCAAATTCAAAATGCCTTTCTCTGGACCAACAATTTCT
ATGCCTGATGTTGATTTTAACCTGAAAGGTCCGAAACTGA
AAGGTGATGTTGATGTTTCTGTTCCAAAAGTGGAAGCAGA
TATTAAAGCACCAAAAGTCGAACTTGAAGGCCCAGAAATT
GAGGGTCCTGAGGGTGGTTTTAAGATGCCAAAGATAAAAA
TGCCACAGATTGGATTCAAGGGTCCAAAAGTGGAAGGTCC
AGATGTCGACGTAAAAATTCCCAAAACTAATATTGACATA
AAGGCACCTGATGTGGACATTAAAGGTCCAGAGATTGACA
TTGAGGGACCTGAGGGAAAAGTCAAGGGGTCTAAGTTCAA
AATACCTTTCTCTGGGCCAAACATTTCTATGCCTGATGTT
GATTTCAACCTGAAAGGTCCGAAACTGAAAGGTGATGTTT
CTGTACCAAAAGTGAAAGGAGATATTAAAGCACCAAAAGT
CGAACTTGAAGGGCCAGAAATTGAAGGTCCTGAGGGTGGT
TTTAAAATGCCAACAATCAAAATGCCAAAATTCGGATTCA
AGGGTCCAAAAGTTGAAGGACCAGGCATGGATGTGAAAAT
CCCCAAGACTGATATTGACATCAAAGGACCTGATGTGGAC
ATTAAGGCTCCAGAGCTTGACATTGAGGCACCTGAGGGAA
ACATCAAGGACCCCAAATTGAAAATGCCTTCACTGTCCAG
GCCAACAATTTCTATGCCAGATGTTGACTTTAATCTCAAA
GGTCAAAAACTGAAAGGTGATGTTGATGTTTCTGTTCCAA
AAATGCAAGGAGAAATTAAAGCACCAAAAGTCGAACTTGA
AGGACAAGACATTGCAGGTCCTGAGGGTGGCTTTAAGATG
CCAAAGATAAAATTGCCACAGTTCGGATTTAAGGGTCCAA
AAGTGGAAGGTCCAGATGTCGATGTAAAAATTCCCAAAAC
TGAAATTGACATTAAGGCACCTGATGTGGACATTAAAGGT
CCAGAGATTGACATTGAGGCACCTGAGGGAAAAGTCAAGG
GCTCCAAGTTCAAAATACCTTTCTCTGGGCCAACAATTTC
TATGCCTGATGTTGATTTTAACCTGAAAGGTCCGAAACTG
AAAGGTGATGTTGATGTTTCAGTTCCAAAAGTGGAAGGAG
ATATTAAAGCACCAAAAGGCGATCTTGAAGGCCCAGAAAT
TGAGGTTCCTGAGGGTGGTTTTAAAATGCCAACAATCAAA
ATGCCAAAATTCGGATCCAAGGGTCCAAAAGTGGAAAAAC
CGGACATAGATGTGAAAATCCCTAAAACTGATATTGATAT
TAAAGCACCTGATGTGGACATTAAGGCTCCAGTGCTTGAC
ATTGAGGGACCTGAGGGAAAAGTCAAGGGCTCCAAATTCA
AAATGCCTTTCTCTGGACCAACAATTTCTATGCCTGATGT
TGATTTTAACCTGAAAGGTCCGAAACTGAAAGGTGATGTT
GATGTTTCAGTTCCAAAAGTGAAAGGAGATATTAAAGCAC
CAAAAGTTGAACTTGAAGGGCCAGAAATTGAGGGTCCTGA
GGGTGGTTTTAAAATGCCAACAATCAAAATGCCAAAATTC
GGATTCAAGGGTCCAAATGTTGAAGGACCAGGCTTGGATG
TGAAAATCCCCAAGACTGATATTGACATTAAGGGACCGGA
TGTGGACATTAAGGCTCCAAAGCTTGACATTGAGGCACCT
GAGGGAAACATCAAGGACCCCAAACTGATAATACCTTCAT
TATCCAGGCCAACAATTTCTATGCCAGATGTTGACTTTAA
CCTCAAAGGTCCGAAACTGAAAGGTGATGTTGATGTTTCT
GTTCCAAAAGTGCAAGGAGATATTAAAGCACCAAAAGTCG
AACTTGAAGGATCAGACATTGCAGGTCCTGAGGGTGGCTT
TAAGATGCCAAAAATAAAAATGCCACAGATCGGATTCAAG
GGTCCAAAAGTGGAAGGTCCAGATGTCGATGTAAAAATTC
CAAAAACTGATATTGACATTAAGGCACCTGATGTGGACAT
TAAAGGTCCAGAGATTGACATTGAGGGACCTGAGGGAAAA
GTCAAGGGCTCCAAGTTCAAAATACCTTTCTCTGGGCCAA
CAATTTCTATGCCTGATGTTGATTTTAACCTGAAAGGTCC
GAAACTAAAAGGTGATGTTGATGTTTCTGTACCAAAAGTG
GAAGGAGATATTAAAGCACCAAAAGTCGAACTTGAAGGCC
CAGAAATTGATGGTCCTGAGGGTGGCTTTAAGATGCCAAC
GATCAAAATGCCAAAATTCGGATTCAAGGGTCCAAAAGTG
GAAGGTCCAGATGTCGATGTAAAAATTCCCAAAACTGATA
TTGACATTAAGGCACCTGATGTGGACATTAAAGGTCCAGA
GATTGACATTGAGGGACCTGAGGGAAAAGTCAAGGGCTCC
AAGTTCAAAATACCTTTCTCTGGGCCAACAATTTCTATGC
CTGATGTTGATTTTAACCTGAAAGGTCCGAAACTGAAAGG
TGATGTTGATGTTTCTGTTCCTAAAGTGGAAGGAGATATT
AAAGCACCAAAAGTTGAAATTGAAGGCCCAGAAATTGAGG
GTCCTGAGGGTGGTTTTAAAATGCCAACGATCAAAATGCC
AAAATTCGGATTCAAGGGTCCAAAAGTTGAAGGACCAGGC
ATGGAGGTAAAAATCCCCAAGACTGATATTGATATTAAAG
GACCTGATGTGGACATTAAGGCTCCAGAGCTTGACATTGA
GGCACCTGAGGGAAACATCAAGGACCCCAAGCTGAAAATG
CCCTCATTGTCCAGGCCAACAATTTCTATGCCTGATGTTG
ACTTTAACCTGAAAGGTCCAAAACTGAAAGGTGATGTTGA
TGTTTCTGTTCCAAAAGTGCAAGGAGACATTAAAGCGTCA
AAAGTCGAACTTGAAGGACCAGACATTGCGGGTCCTGAGG
GTGGCTTTAAGATGCCAAAGATAAAAATGCCACAGATCGG
ATTCAAGGGTCCTAAAGTGGAAGGTCCAGATGTCGATGTA
AAAATTCCCAAAACGGATATTGACATTAAGGCGCCTGATG
TGGACATTAAAGGTCCAGAGATTGACATTGGGGGACCTGA
GGGAAAAGTAAAGGGGTCCAAGTTCAAAATACCTTTCTCT
GGGCCAAACATTTCTATGCCTGATGTTGATTTTAACCTGA
AAGGGCCAAAACTGAAAGGTGATGTCGATGTTTCTGTTCC
TAAAGTGGAAGGAAATATTAAAACTCCAAAAGTCGAACTT
GAAGGCCCAGAAATTGAGGGTCCTGAGGGTGGTTTTAAAA
TGCCAACGATCAAAATGCCAAAATTTGGATTCAAGGGTCC
AAAAGTTGAAGGACCAGGCATGGATGTGAAAATCCCTAAG
ACTGATATTGACATTAAAGGACCTGATGTGGACATTAAGG
CTCTAGAGCTTGACATTGAGGCACCTGAGGGTAACATCAA
GGACCCCAAGCTGAAAATGCCTTCATTGTCCAGGCCAACA
ATTTCTATGCCAGATGTTGACTTTAACCTCAAAGGTCCGA
AACTGAAAGGTGATGTTGATGTTTCTGTTCCAAAAGTGCA
AGGAGATATTAAAGCACCAAAAGTCGAACTTGAAGGATCA
GACATTGCGGGTCCTGAGGGTGGCTTTAAGATGCCAAAAA
TAAAAATGCCACAGATCGGATTCAAGGGTCCAAAAGTGGA
AGGTCCAGATGTCGATGTAAAAATTCCCAAAACGGATATT
GACATTAAGGCACCTGATTTGGACATTAAATCTCCAGAGA
TTGACATTGAGGGACCTGAGGGAAAAGTAAAGGGGTCCAA
GTTTAAAATACCTTTCTCTGGGCCAAAAATTTCTATGCCT
GATGTTGATTTCAACCTGAAAGGTCCGAAACTGAAAGGTG
ATGTTGATGTTTCTGTTCCTAAAGTGGAAGGAGATATTAC
AGCACCAAAAGTCGAACTTGAAGGCCCAGAAATTGAGGGT
CCTGAGGGTGGTTTGAAAATGCCAACGATCAAAATGCCAA
AATTCGGATTCAAGGGTCCAAAAGTTGAAGGACCAGGCAT
GGATGTGAAAAGCCCCAAGACTGACATTGATATTAAAGGA
CCTGATGTGGACATTAAGGCTCCAGAGCTTGACATTGAGG
CACCTAAGGGAAACATCAAGGACCCCAAGCTGAAAATGCC
TTCATTGTCCAGGCCAACAATTTCTATGCCAGATGTTGAC
TTTAACCTCAAAGGTCCGAAACTGAAAGGTGATGTTGATG
TTTCTGTTCCAAAAGTGCAAGGAGATATTAAAGCACCAAA
AGTCGAACTTGAAGGATCAGACATTGCGGGTCCTGAGGGT
GGCTTTAAGATGCCAAAAATAAAAATGCCACAGATCGGAT
TCAAGGGTCCAAAAGTGGAAGGTCCAGATGTCGATGTAAA
AATTCCCAAAACGGATATTGACATTAAGGCACCTGATTTG
GACATTAAATCTCCAGAGATTGACATTGAGGGACCTGAGG
GAAAAGTAAAGGGGTCCAAGTTCAAAATACCTTTCTCTGG
GCCAAAAATTTCTATGCCTGATGTTGATTTCAACCTGAAA
GGTCCGAAACTGAAAGGTGATGTTGATGTTTCTGTTCCTA
AAGTGGAAGGAGATATTACAGCACCAAAAGTCCAACTTGA
AGGCCCAGAAATTGAGGGTCCTGAGGGTGGTTTTAAAATG
CCAACGATCAAAATGCCCAAATTCGGATTCAAGGGTCCAA
AAGTTGAAGGACCAGGCATAGATGTAAAAAGCCCCAAGAC
TGACATTGATATTAAAGGATGTGATGTGGACATTAAGGCT
CCAGAGCTTGACATTGAGGCACCTGAGGGAAACATCAAGG
ACCCCAAACTGAAAATGCCTTCATTGACCAGGCCAACAAT
TTCTATGCCAGATGTTGATTTTAACCTGAAAGGTCCAAAA
CTGAAAGGTGATGTTAATGTTTCTGTTCCAAAAGTGGAAG
GAGATATTAAAGCACCAAAACTTGAACTTGAAGGCCCAGA
AATTGAGGGCCCTGAAAGTGGCTTTAAGATGCCAAAGTTT
AAAATGCCACATATCGGATTCAAGGGTCCAAAATTGGAAA
GTCCAGACTTGGATGTGAAAATCCCTAAAGCTGATTTTGA
GGTTAAGTCACCTGATTTGGACCTTAAAACTCCAGAGCTT
GACATTGAGGGACCTGAGGGAAAAGTCAAGGGCTCAAAGT
TCAAAATGCCTTTCTCCGGGCCAAAAATTTCTATGCCTGA
TGTTGATTTTAACCTGAAAGGTCCGAAACTGAAAGGTGAG
GTCGATGTTTCTGTTCCAAAAGTGAAAGGAGATATTAAAG
CAACCGAAGTAGATATTAAAACTCCACAAATTGACATTGA
GGGACCTGAAGGAAAACCTAAGGGCTCTAAATTCAGTATC
CCATCAATATCTGGCCCAAATATTTCCATGCCAGATGCTG
ATTTTAGCCTCAAAGGTCCGAAACTGAAAGGTGATGTTGA
TGTTTCAGTTCCAAAAGTAGAAGGGGATATCAAAGCTCCA
AACGTTGAAATTGAAGGCCCAGATATTAAAGGACCTGAGG
GTGGTTTTAAGATGCCAAAGATCAAAATGCCAAGATTTGG
GTTCAAAGGTCCAAAAGTGGAAGGTCCAGATGTCGAAGTC
CCCAAAACTGATATTGACATCAAAGCACCTGATGTGGACA
TTAAATCTCCTGAGCTTGACTTTGAGGGACCTGAAGGCAA
GGTCAAGGGCTCCAAGTTTAAAATGCCTTTCTCTGGGCCA
ACGATTTCTATGCCTGATGTTGATTTTAACCTGAAAAGTC
CAAAACTGAAAGGTGATGTTTCTGTTCCAAAAGTGGAAGG
AGATATTAAAGCACCAAAAGTCGAACTTGAAGGCCCAGAA
ATTGAGGGTCCAGAAGGTGGCTTTAAGATGCCAAATATCA
AAATGCCAAAATTCGGATTCAAGGGTCCAAAAGTTGAAGG
TCCAGATGTCGATATAAAAATTCCCAAAACTGATATCGAC
ATTAAGGCACCTGATGTGGACATCAAAGGTCCAGAGATTG
ACATTGAGGGACCGGAGGGAAAAGTTAAGGGCTCCAAGTT
CAAAATACCTTTCTCTGGGCCAACAATTTCTATGCCGGAT
GTTGATTTTAACCTGAAAGGTCCGAAACTGAAAGGTGATG
TTGATGTTTCAGTTCCAAAAGTGAAAGGAGAGATTAAAGC
ACCTGACGTGGTTGTTAAAACCCCAAAAGTTGACATTGAG
GGACCTGAAGGAAAACTTAAGGGCCCTAAATTTAACATTC
CATCAATTTCTGGGCCAAATATTTCTATGCCTGATGTTGA
CTTTAACCTGAAAGGTCCAAAACTGAAAGGTGATGTTTCT
GTTCCAAAAGTGGAAGGAGATATTAAAGCACCAAAAGTTG
AACTTGAAGGCCCAGAAATTGAGGGCCCTGAAAGTGGCTT
TAAGATGCCAAAGTTCAAAATGCCACATATCGGATTCAAG
GGTCCAAAAGTGGAAGGTCCAGATGTCGATGTAAAAATAC
CCAAAACTGAAATTGACATTAAGGAACCTGACTTGGACAT
TAAAGGTCCAGAGCTTGATATCGAGGGACCTGAAGGAAAA
GTCAAGGGCCCAAAATGGAAAATGCCTTCTTTCTCCAGAC
CAACAGTTTCTGTGCCAGATGTTGATTTCAACCTGAAAGG
TCCGAAACTGAAAGGTGATGTTGATGTTTCTCTTCCAAAA
GTGGAAGGAGGTGTTAAAGCACCAAAAGTCGAACTTGAAG
GCCCAGACATTGAGGGTCCCGAGGGTGGCTTTAAGATGCC
AAAGTTCAGATTGCCAAAGTTTGGATTCAAGGGTCCAAAA
GTGGAACGTCCAGACATGGATATGAAAATCCCTAAAGCTG
ATTTTGAGGTTAAGTCACCTGATTTGGACATTAAATCTCC
AGAGATTGACATTGAGGGACCTGAAGGAAAAGTCAAGGGC
CCCAAATTGAAAATGCCTTCTTTCCCCGTGCCAAAAATTT
CTATGCCAGATGTTGACTTTAACCTGAAAGGTCCGAAACT
GAAAGGCGATTTCGATGTTTCTGTTCCAAAAGTGGAGGGA
GATTTCAAAGCACCTGATGTGGATGTTAAAACTCCAAAAG
TTGACATGGAGGGACCTGAAGGAAAATTTAAGGGCCCTAA
ATTCCAGATGCCATCATTTTCTGGGCCAAATATTTCTATG
CCTGATGTTGACTTTAATATCAAAGGTCCAAAACTGAAAG
GTGATGTTGATGTTTCTGTTCCAAAAGTGCAAGGGGATAT
TAAAGCACCAAAAATTGAACTTGAAGGCCCAGACATTGAG
GGTCCTGAGGGTGGCTTTAAGATGCCAAATATCAAAATGC
CAAAATTCGGATTCAAGGGTCCAAAAGTGGAAGGTCCTGA
CATGGATGTGAAAATCCCTAAATCTGATTTTGAGGTTAAG
TCACCTGACTTGGACATTAAATCTCCAGAGATTGACATAG
AGGGACCTGAAGGAAAAGTCAAGGGGCCCAAATTTAAAAT
ACCTTCTTTCACTGGGCCAAAAATTTCTATGCCAGATGTT
GATTTTAACCTGAAAGGTCCGAAACTGAAAGGTGATGTCG
ATGTTTCGGTTCCAAAAGTGGAAGGAGATATAAAGCTCCC
TGGTTTGGATGTTGAAGCTCCAAAAGTTGACATGGAGGGA
AGTGAGGGAAAACTTAAGGGTCCTAAATTCAGTATGCCAT
CAATATCTGGCCCAAATTTTTCCTTACCAAATGTTGACTT
TAACCTCAAAGGTCCAAAACTAAAAGGTGATGTTGATGTT
TCTATTCCAAAAGTGGAAGGAGGTGTTAAAGCACCAAAAG
TTGAAATTGAAGGCCCAGACATTGAGAGTTCCGAGGGTGG
CTTTAAGATGCCAAATATCAAAATGCCAAAATTCGGATTC
AAGGGTCCAAAAGTGGAAGTTCCTGACATGGATGTGAAAA
TCCCTAAAGCTGATTTTGAGGTTAAGTCACCTGATTTGGA
CATTAAATCTCCAGAAATTGACATGGAGGGACCTGAAGGA
AAAGTTAAGGGCCCCACATTGAAAATGCCTTCTTTCTCTG
GGCCAAAAATTTCTATGCCAGATGTTGACTTCAACCTGAA
AGGTCCGAAACTCAAAAGCGATGTCGATGTTTCTGTTCCA
AAAGTTGAAGGAGGTATTAAAGCACCAAAAGTTGAAATTG
AAGGCCCAGACATTGAGGGTCGCGAGGGTGGCTTTAAGAT
GCCAAATATCAAAATGCCAAAATTCGGATTCAAGGGTCCA
AAAGTGGAAGGTCCCGACATGGATGTGAAAATCCCTAAAT
CTGATTTTGAGATTAAGTCACCTGACTTGGACATTAAATC
TCCAGAGATTGACATTGAGGGACCTGAAGGAAAAGTCAAG
GGGCCCAAATTTAAAATACCTTCTTTCTCCGGGCCAAAAA
TTTCTATGCCCGATGTTGATTTTAACCTGAAAGGTCCGAA
ACTGAAAGGTGATGTTGATGTTTCGGTTCCAAAAGTGGAA
GGAGATATAAAGCTCCCTGGTTTGGATGTTAAAGCTCCAA
AAGTTGACATGGAGGGAAGTGAGGGAAAATTTAAGGGTCC
TAAATTCAGTATGCCATCAATATCTGGCCCAAATTTTTCC
TTGCCAAATGTTGACTTTAACCTCAAAGGTCCAAAACTGA
AAGGTGATGTTGATGTTTCTGTTCCAAAAGTGGAAGGAGG
TGTTAAAGCACCAAAAGTTGAACTTGAAGGCCCAGACATT
GAGAGTCCTGAGGGTGGCTTTAAGATGCCAAATATCAAAA
TGCCAAAATTCGGATTCAAGGGTCCAAAAGTGGAAGGTCC
TGACATGGATGTGAAAATCCCTAAAGCTGATTTTGAGGTT
AAGTCACCTGATTTGGACATTAAGTCTCCAGAGATTGACA
TAGAGGGACCTGAAGGAAAAGTCAAGGGCCCCACATTGAA
AATGCCTTCTTTCTCTGGGCCAAAAATTTCTATGCCAGAT
GTTGACTTTAACCTGAAAGGTCCGAAACTGAAAAGTGATG
TCGATGTTTCTGTTCCAAAAGTTGAAGGAGGTATTAAAGC
ACCAAAAGTTGAAATTGAAGGCCCAGACATTGAGGGTCGC
GAGGGTGGCTTTAAGATGCCAAATATTAAAATGCCAAAAT
TCGGATTCAAGGGTCCAAAAGTGGAAGGTCCCGACATGGA
GGTGAAAATCCCTAAAGCTGATTTTGAGGTTAAGTCACCT
GATTTTGACATTAAATCTCCAGAGATTGACATTGAGGGAC
CTGAAGGAAAAGTCAAGGGCCCTAAATTCCAGATGCCATC
AGTTTCTCGGCCAAAAATGTCTATGCCTGATGTTGATTTT
AACCTGAAAGGTCCGAAACTGAAAGGTGATGTCGATGTTT
CTGTCCCAAAAGTTGAAGGCGGTATTAAAGCACCAAAAGT
TGAAATTGAAGGCCCAGACATTGAGGGTCGCGAGGGTGGC
TTTAAGATGCCAAATATCAAAATGCCAAAATTCGGATTCA
AGGGTTCAAAAGTGGAAGGTCCGGAAATGGATGTGAAAAT
CCCTGAAGCTGATTTTGAGGTTAAGTCACCTGATTTGGAC
ATTAAATCTCCAGAGATTGACATTGAGGGACCTGAAGGAA
AAGTCAAGGGCCCTAAATTCCAGATGCCATCAGTTTCTCT
GCCAAAAATTTCTATGCCAGATGTTGATTTTAACCTGAAA
GGTCCGAAACTGAAAGGTGATGTCGATGTTTCGGTTCCAA
AAGTGGAAGGAGATATAAAGCTCCCTAGTTTGGATGTTGA
AGCTCCAAAAATTGACTTCGAGGGAAGTGAGGGAAAACTT
AAGGGTCCTAAATTCAGTATGCCATCAATATCTGGCCCAA
ATTTTTCCTTGCCAAATGTTGACTTTAACCTCAAAGGTCC
GAAACTAAAAGGTGATGTTGATGTTTCTGTTCCAAAAGTG
GAAGGAGGTGTTAAAGCACCAAAAGTTGAACTTGAAGGCC
CAGACATTGAGAGTCCCGAAGGTGGCTTTAAGATGCCAAA
TATCAAAATGCCAAAATTCGGATTCAAGGGTCCAAAAGTG
GAAGGTCCCGACATGGATGTGAAAATCCCTAAAGCTGATT
TTGAGGTTAAGTCACCTGATTTGGACATTAAGTCTCCAGA
GATTGACATTGAGGGACCTGACGGAAAAGTCAAGGGCCCC
ACATTGAAAATGCCTTCTTTGTCCGGGCCAAAAATTTCTA
TGCCAGATGTTGATTTTAATCTGAAAGGTCCGAAAGTAAA
AGGCGATGTTGATGTTTCTGTTCCAAAAGTGGAAGGAGAT
ATAAAAGTCCCTGGTTTGGACATTAAAGCTCCAAAAGTTG
ACATTGAGGGACCAGAGGGAAAACTTAAGGGCCCTAAAAT
TAATATTCCTTCAATATCTGGCCCAAATATTTCCTTGCCA
ACTGTTGACTTTAACCTCAAAGGTCCAAAACTGAGAGGTG
ATGTTGATGTTTCTGTTCCCAAAGTGAAAGGAGATGTTAA
AGCACCCGATCTGGATATTAAAACTCCTGAAATTGACATT
GAGGGAGCTGAGGGAAAAATTAAGGGCCCTAAATTTAGGA
TACCATCTGTCTCCATGCCAAAGATTTCTATGCCAGAAGT
TGATTTCAATCTGAAAGGACCAAAACTGAAAGGTGATGTT
GATTTTTCCGTTCCAAAAGTCGAAGGAGACGTAAAGGCAC
CTGATGTTCATATCAAGGGTCCAGAGGTTGACGTAGAGAC
ACCTGAAGGAAAAATCACAGGCTCCAAATTCAAGGGGCCA
TCATTTTCAGGTCCAAATATTTCTCTCCCAGATGTTGACT
TCAACTTGAAAGGACCTAAACTAAAGGGTGGTGTTGATGT
GTCCGTTCCAAAAGTTCAAGGGGATATTAAAGCCACAGAT
TTTAACATTAATCTGCCGAATATTGATGGTGATATACCTG
AAGGAAAAGTAAAGGGCCCAAAACTTAAGATGCCATCTTT
ATCCGGCCCTGAAGGCTCCATTGAGGTTAATTTACCAGAA
ACAAATGTGAAAAAGCCAAAGTTTAAAATGCCAAAGTTTA
AATTTCCGTCATTTGGGCACAAAGGTCCAAAAGTGGAAGG
CCCTGATGTTGATGTAAAAATTCCTAAGGCTGATATCAAA
TTTAAATCACCAGATTTGGACAATGAATCTCCAGAGCTTA
ACATTGAGGGACCGAAGGGAAAAATCAAGGCCTCCAAATT
TAGTATGCCAACAATTTCTGGTCCAAAGGTTTCAATGCCA
GATGTTGATCTAAACCTGAAACGTCCGAAACTGAAAGGTG
ACGTTGATGTTTCAGTTCCAAAAGTAGAAGGAAATATTAG
TGTACCTGATGTGGATCTTAAATCTCCTGAAGTGGAATTT
GAGGGACCTGAGGGAAAAATTAAGGGCCCCAAAGGGAAAA
TTCCATTACTGTCAGGGCCAAATATTTCTATGCCACACGT
TGACTTCAACCTCAAAGGTCCAAAATTGAAAAGTGATGTT
GATGTTTCTGTCCTGAAAGTGGAAGGAGATATTAAAACAC
CAAAGATTGAACATGAAGGACCAGACATTGAGGGTCCTGA
GGGTGGCTTTAAGATGCCAAAGCTCAAAATTCCACAGTTT
GGATTCAAGGGCCCAAAAGTGGAAGGTCCAGACATGGATG
TTAAAATCCCCAAAACCGATATTGACATTAATGCACCTGA
TGTCGACATTAAAGCTCCAGAGCTTGACATCGATGGACCT
GAGGGAAAAATCAAGGGCCCTAAATTGACAAAGCCTTCTT
TATCTGGGCCAACAATTTCTATGCCAGATGTTGATTTTAA
CCTAAAAGGTCGGAAAATGAAAGGTGATGTCGATGTGTCT
GTTCCAAAATTGCAAGGAGATATAAAGGTCCCTGGTATGG
ACATTAAAGGTCCACAAGTTGACATTGAGGGACCTGAGGG
GAAAATCAAGGGCTCTAAATTCAGTATGCCTTCAATATCT
GGCCCAAAAATTTCCATGCCTAATGTTGACTTTAACCTCA
AAGGGCCAAAACTAAAAGGTGATGTTGATGTTACAGTTCC
AAAAGTAGAAGGAGACATGAAGGCACCAAAAGTTGAACTT
GAAGGCCCAGACATTGAGGGTCCTGAGGGTGGTTTTAAGA
TGCCAAAGGTCAAAATGCCAAAAATTGGATTCAAGGGTCC
AAAAGTTGAAGGTCCAGATGTTAATGTACAAATCCCTAAA
ACTGATATTGACATTAATGCACCCGATGTGGACATTAAAT
CTCCAGAGCTAGAAATTGAGGGACCTGAGGGTAAAGTCAA
GGGCCACAAATTAAAAATGCCTTTCTCCGGCCCAACAATT
TCTATGCCAGATGTTGATTTTAATCTAAAAGGTCTAAAAC
TGAAAGGTGATGTTGATGCATCTGCTCCGAAAGTGAAAGG
AGATATTAAAATACCCAATGTGGATATTAAAGGTCCTGAA
GTTGACATTGAGGGACCTGGGAGAAAATTTAAGGGCCCTA
AATTTCAGATGCCATCAGTTTCTGGGCCAAATATTTCCAT
GCCTGATGTTGACTTTACGATGCCAGATGTTGATGTAAAC
CTGAAAGGCCCAAAACTGAAAGGTGATGTCGATGTTTCTG
TTCCAAAAGTTGAAGGACATATAAAAGCACCAAAAGTGGA
TATTGAAGGTCCTGATTTTGATGTAGATGGTCCAGAAGTT
GGCTTTAAGATGCCCAAATTGCCATCACTTGGCCTTAAAG
GGCCAAATGTGGAGGGCCCAGAAATTGGTGTGAAAATCCC
TAAAACCAATATTGATGTCAAGGCTCCTGGAGTTGACATT
GAATCTCCAGATCTTAATATTGAGGGACCTGATGGAAAAA
TAAAAAGCCCTAAATTCAAGATCCCGACAGTTTCTATTCC
AAAGGTTCCCATGCCAGATGTTGACTTTAACTTGAAAGGT
CCTAAACTGAAAGGAGATGTTGATGTTTCTGTACCCAAAA
TGGAAGGAGATATTAACGGAGCAAAAGTTAAATTTGAAGG
CCCAGGCTATGAAGGTCCTGAGGGTGGCTTTAAGATCCCA
AAGATGCCATCATTTGGACTTAAGGGTCCAAACGTGGAAG
GACCAGATGTTGACATAAAACTCCCAAAAGCAGGTGTTGA
TGTTAAAGGACCTGAAATTGAGGTCAAATCTCCTGATCTT
GAAATTAAGGGACACGAAGGAAAAATTAAGGGTCCTAACT
TCAAAATGCCTTCTTTATCTGGTCCACAGATTTCTATGCC
AGATATTAATATCAAAGGCCCCAAAGTCAAGGGTGATATG
GGGATTTCTGGACCGAAGACTGGAGGTGACCTAAAGTCTG
CAAAAGTGGACATTAAAGGTCCTCATGTTGATTTAGAGAG
CCCTGAAGGTGGACTAAAAATGCCAACGATAAAAATGCCA
GCATTCGGATTCAAGGGTCCAAAAGTGGACGGTCCAGATA
TTGATTTCAATCTCCCGAAAACAGATGTTGATATGAAAGG
ACCCGAAATCGACATTAAAACTGCTGATCTTGACACTGAT
GGACTTGGGGGTGGTCTAAAGAATGTGAAGTTTCCAAAAT
TTAAAGGTCCTCACTTTGGAATCAAGACTTCGGGTGGCAG
TCTTTCAGTTCCTGAACAGGATGTTGAGGCAACCATAGAT
GCCAAAAGCCCTGATGTTACCCTCAGTGGACCAGATGCAA
ACATCAAAGTGCCAAAAACTAAGAAATCTAAATTTTCACT
TGGAGTTAGGAGCCCAAAGTTAGATGCAGATATCCCTGAT
GCTGGTGGTAATTTTGAAGGACCTGACATGAATGTAGATG
TCAAAGGAAAAAAGGGTAAATTCAAATTGCCAAAAGGGAA
AGGGAAGTCTAAAACATTTGATGCTGATTTAAAGACGGAA
ATGGTCGAGTTGGAGACAAATGAACCTGAAATTCACATAA
AGTCCACCAAAGTAAAGAAACCTTTTTTTGGAAGGTTACA
TTTTCCTGATGTGGAATTTGACATAAAATCTCCAAAAGTT
AAAGCTAGTTCATCTGCATCTGGAACCATGAAATCATCAG
ATGTTGATTTGCCATCGGCAAGCCTTAAAACTGACATTCA
GACACCAGATGCTAGTTTGGACAGTCCAGATTTGAAAACG
AAAGGGGCAAAAGTAAAAATGTCAAAATACAGCATGTCTA
GCTCCAAACTAAAAACTTCAGACTTGGATGTTAGAGATGC
AACATTGGAGATTCCAGAGAAGACCATGCATTCTCCAGAT
GTCAGTGTAGCAGGATCAGGGATTAATGGAAAACGCAGTG
CTAAAATTGACATAGAAGGAAAAGTACAAAGTGTTGAGTC
GGCAGTGCCATCTACAAATGTCAGCGGGGGGGTTATAGAT
GCTGATTTAGGTATCGCTGAACAGAAAGGAGTAAAAGGGA
GCATTGGAATAGCTGGCTTTAATGTAGGAGGACAAAAGGA
AGATACTGCAAGTGGGATAGGCTTGAAGTCAGATGCATCA
TTATCTGGTGGGATAGAGAATCAAGAAGGTAATTTAACAT
TTCCTAAAGTCAAAGTACCAAAGTTTGGTATTGCATTGCC
TAGAGTAGAACCAAGAGAAATGCGAGAAGATATAGGTTCG
GGTGAATTGGCTGGTGGAGCTAAAGTTAGTTCTCAAGGTT
TAGAAATGCAGAAAACTGATGTCAAAAGCAGTGGTGGCAA
AGTGAAAGTAAAAATGCCGAAGCTGTTTGTCAAATCTAAA
TCTAAAGGTGGCAGTGCAGCTGATCTAACTGTTGAGGGAG
AAGATGCTGATGCTACTAGTAAAGGTGCTGCTAAAGTGTC
TAAGGAGTTGAGTCTTAGTTCTGGGGAACTGACAAGTGGC
AAGTTAACAGTAGAGGAAAGCTCTGGATTTAAAGTTTCTC
CAAAGAGTAAATCTGCCTCTCTTGACTTCTTTAAAAAGTC
ACGACATCACTCATCCTCTGTCAGTGAAGAGGGAGCCTTA
GCTTCACCTGTTTCTACTGAAGGGCACTTACAAGCAGAAG
CTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTTAA
AGGCAAAAAAGGAAAGTTGAAGTTCTCTACAATTGGAGGT
TTTAGTTCAAAAAGTAAAGGTTCATATGAAGTGACTGATG
AGAGTGAGGCTATGACTGAGAGTGCTAGTGGGGTTGCTCA
GCCTTCAAAGAAGTCCAGAATGTCATCGTCATCTAGCAGT
GATAGTGGTACAAAAGGTAGTATTCGGTTACCACAACTCG
AGATATCAGTTTCACCAAAAAAATAAGTTTTTACGTTGAT
ATCTAGGCACAGTTCAAATACATTTATTTTATTATGTCAG
TCTAGATGATTATCGTAAATCTGGCTTTCATTGTAATTAT
AATGCACTGCCTTATAAACTGTTTCTTCAGTTTCCAAAAA
TGCTCTTTACAGGCATTGATATTATTTGAATCACAATTTA
ACTGTAAATAAGAGAAAACTGTAGGTAATTTTAAATTTTT
TTTGTAGATAGGAAATTCAGATTCAATCCAAAAATGTGTG
TACTTAATATAAAAAAGAAATCGATGCGAGTTGTCATCAG
ATAATGTGGTATATTTTTCTATGTTTTGACTTGGTTTTGT
GACTCCTTTCTAAAATTGTCTAAACACGTTTACATGCAAG
AGGCATGATTTTAATTAAAACTGAAAGGATTTTATGACTT
CAACTTCACATATATTTAGTGCTGTATCACATGTACTTAT
CACTGATGAAAATCTAATTTTAAACAAAGCATTAGTAAGC
AGAATGAAGTTTAAGGGCTGTAAAAATTGTAAATAAATTG
ATTCAGAATAGATGCATGGGATTATATTACTTTGTGTCCC
AAATAATATGGCAGTTCAGATATTCTGTTATGAAATTTAC
ACAGAGATTATTATCTTCTAAAGTATTTATATCTTTTCTA
TAATTGAATTGCTTTAAAATGCACACATGGAGCAGCTGAC
AAAGGGCTGTGACTGGCTTTGATGTTTTAAATGATTTCAA
AGGCATTTTAGTTGTATCTTCCACATTTCTTTACATCCAA
TTGACTCTCTCTCTTCCTCTTACTACATTAATGAAATGTC
GTGCTGCAAAGTGGTGATTATACCTACAGAAATGCTAATG
ATTAAACAATATTTTTTAAAAGGCTAAAATGTACATCACC
TTTGTAAATAGTGGGACATTTAGGCTGTATGTTTCTAACT
TTTTCTTGTATCTGTTGCAAAAAAATTTAATAAAGAGTTC
AATTCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations