header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-556
Transcript Name: prkacba-201
Previous Name: prkacba-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049571 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049571|OTTDARG00000034916|ZDB-GENE-040426-1351 prkacba|OTTDARP00000038890 prkacba-001 LG_ CR931978.18 Danio rerio protein_coding KNOWN, 2483 bp
ATCATTTGCACAGAATAGTCTACTCGAACAGGAAGTATAA
CTAGCTCAGCTGGTGGTAAGGCAAACACTTGAATAGAAAT
CTAAGCATCTAAAACAGGAAATGACTATGACATCTCTGTG
CTGCAGACAGTTGAGTTGAAGAGCATCTGTGGTTATCAAC
AAATTTGAAAGTTTCTTCTGTGTGAACAGCGCGTGTAATG
GCCCAGCCAAAGGATCCACACTTTGGCCATTCATCAGGCA
CTAACTCTGCCCTTCAGAAGCTGGACACTTTAGCTAGCCG
TTTTTTTTACAAATGTCGAAAAGGAAACCATGACAAAGGA
CTGGAGAATGAGGGGCCGCATGTGTCAGAGCACACTGTCC
TTTGGGATACAGCAATGAAGGAAACTCTGGCAAAAGCTAA
AGAGGATTTCTTGAACAAATGGGAGTGCCAGCAAAAGAGC
ACAGCATGTCTAGATGACTTTGACAAACTGAAAACTCTCG
GCACTGGATCTTTTGGACGAGTAATGCTTGTCAAACACAA
ACAGTCAGAACAGTATTTTGCGATGAAGATTCTGGACAAA
CTAAAAGTGGTGAAGCTGAAACAGATTGAACACACATTAA
ACGAGAAGAAAATATTACAAGCGGTCTCCTTTCCTTTCCT
TGTAAAACTTGAGTGCGCTTTTAAGGATAATTCAAATTTA
TACATGGTCATGAGATATATCCAAGGTGGTGAGATGTTCT
CACATTTGAGAAGGATTGGAAGATTCAGTGAACAGAATGC
ACGTTTCTATGCGGCTCAGATTGTTCTGACGTTTGAGTAT
CTTCACATGCTGGACCTCATCTACAGGGACCTGAAACCTG
AAAACCTGCTCATTGATCATCAGGGATACATTCAGGTAAC
AGATTTTGGATTTGCCAAAAGAGTCAAAGGCAGAACTTGG
ACATTGTGTGGAACACCAGAATACCTGGCACCAGAAATCA
TTCTCAGCAAGGGCTACAACAAGGCTGTTGACTGGTGGGC
ACTGGGTGTTCTGATCTATGAAATGGCTGCTGGATATCCG
CCTTTCTTCGCTGATCAGCCTATTCAGATTTATGAGAAAA
TTGTGTCTGGCAAGGTACGATACCCCTCACACTTCAGCTC
AGACTTGAAGGACCTTTTACGCAATCTACTGCAAGTGGAC
CTCACAAAGCGCTTTGGCAATTTGAAAAATGGAGTCAGTG
ACATTAAAAACCACAGATGGTTCGCTTCCACAGACTGGAT
TGCAATCTATGAGAAGAAGGTGGATGCACCCATCATACCA
AAGTGCAGAGGGCCTGGCGACACGAGTAACTTTGACGAAT
ATGACGAAGAAGTCATACGGGTATCTGTCTCAGAGCAATG
TTCAAAAGAATTCTTGGACTTCTAGAGTCACTGTAAGAGC
TTAAAGAGGAGTTCCTACAGATACTTTGTTTTGTTTTGCA
AAAAAATATATAAAATGAATAAAAAACACATTCATGGGTG
AATCCAAGAACATCACTTGATACATGGCTTCATTCAAGGA
GACTTAGTGATCTGAGTAGAAATACACCAATTTAGTGTAC
TGCATTATTGAAGACCACATGCCATTTTTTTAAGCGATTC
TGGTGAAATTTAGAGATTTAAATAATATTTTCCTTGTGTC
CTTTTTTAGTTTTATACCAATTAATTTATAAAACGAATAT
GCTATTGTTAATTGGGTCCCACTTTATAATAAGTGGCCTT
AACTAATATGTACTTACACAGGAATTAATAGTTTGTTACA
ATGTACTTATTGTGTAAATACATGCATTTACTGTGTACTT
ATGCTTGATTAAATACATGTATGTAATTACATCTGTAATT
AACTTTAGTAATTACATTTGTAAATACACTGTTGAACATC
CCTTGCACCTTAACCCACCCTTAAACCTGTCCATACCCAA
CCTCTATCCCAACTCAAAAGCACCTCAAGTATTCTCAAAT
ACATTATAAACACAGTAAGTACATTGTATTTATTTATTTA
TTTATTATTTTTTTTATATAAGTACATAGTAGTTAAGGAC
ACTTAATATAAAGTGGGGCCGTTAATTGTTCTTAAGTGTT
TTATTTTATGTAAGAACTTTTGCTGTTTGCAATACAAAAA
TACATGTTTATTATATTAGGTGAATTATCCATTACACATG
GCATGTGTGTGTTCAGAAATTTGAAAGGTGCAATGTAAAA
ACAACATATTTTGAATGCTTTTATCCAATTCTGAGGCTAC
ACAGATCCTGTGAAACAATGGTAAAAAAATCAATTAGAAA
TCCCCCTGATATTTAATTTGATGTCTTGAATGTCCCTGAA
ATGGTGATAAAAAGATGAGAATCAGCAAACTGTTATTTGT
CTTCCTATGACCCATACAGTATGAATAGATTTATTTTAGA
TGTGTATTATAGCTGCTACAGAGATTATACTGTACGATTT
TGAGAAAGATTATTTTGAACATGAATAAAATAAAATAATT
GAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prkacba-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049571 (1),  Ensembl_Trans:ENSDART00000011183 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC053227 (1) 2433 bp
GenBank:BC165279 (1) 1255 bp
GenBank:CK691771 (1) 728 bp
CITATIONS (2)