ZFIN ID: ZDB-TSCRIPT-110325-534
Transcript Name: ube2d2l-201
Previous Names: ube2d2-001, ube2d2l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049500 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049500|OTTDARG00000034866|ZDB-GENE-030131-7384 ube2d2l|OTTDARP00000038828 ube2d2-001 LG_ CU929193.13 Danio rerio protein_coding KNOWN, 1525 bp
GAGAGAGAGAGGTGGAGACACAATCACACACGCTCATACA
TACCTATACAAGTGCTCATTGGAGAAGCTCAGGCCTTCCC
GTTCACACTCTCTGTAACTTTGCTCCTCGGCGGGATTATT
ATTGTCTGACCGCTGGACTTCCGCAGGTTTATTCAACGTT
CGCGGCTCGGTTTGTCGGTTTCCGGTTCTGCTCGTCGGGT
TTCTGTCGGATCTTCAGAGTCTGGCTAGCGAGCACAGCTA
ACCGCAGCTAGCCGGATAAACCTGCTCTGTCCTCGGCCTC
AGGAGCACATCACAACACACTATGGCATTAAAACGAATTC
ACAAGGAATTGACTGATCTGGGTCGGGATCCTCCAGCGCA
GTGCTCCGCGGGACCCGTCGGCGATGACTTGTTTCACTGG
CAAGCTACAATTATGGGTCCTAATGACAGTCCATATCAAG
GCGGTGTGTTTTTCTTGACTATTCATTTTCCTACAGACTA
CCCTTTCAAACCACCTAAGGTTGCGTTCACCACAAGAATT
TATCACCCAAATATTAACAGTAATGGCAGCATCTGTTTGG
ATATTCTAAGGTCACAGTGGTCTCCTGCATTAACTATCTC
TAAAGTTCTTTTGTCCATCTGCTCGCTGTTATGTGATCCA
AACCCAGATGATCCGTTAGTGCCAGAGATAGCACGTATCT
ATAAAACAGACAATGAAAAGTACAACAGAATAGCTCGGGA
ATGGACTCAAAAATACGCCATGTGATACCAGAGGAGCCAA
TCTGCAGTATAGCTGGAAAAAAAATCAACTTTTCTTATTA
TTTTCTTCTCCTCCTTTACTTTGTTTTTGTTGTTCTTCCC
TCAACGAATTGACGGATCCGGTGTAAATCCAGACCATATC
AGCTCTGCTCAGTCCTCCCGACCCCATCAGCAGTCATTCA
ATCACACTGTAAAAACACAACGAGACCACAACATGATAAA
GACCCACACTTTGTTTGGTGTTCAGAAAACGCTCGTGTCA
AAGAAGCATGTTTTAACTACGAGCTCAGCCATTTTTTATT
ACGGTACACACAGAGTGAAACGCTTCTGACTCCCGCCACT
GGCTATAGAGGTGCTATTCAAGAAGTCGATCTTTTGCTTT
CATGTTTTTATATGCTTTTACAATAGCAATGAGAACTTCG
GTCTGTGAAATATATATATATTCTTGCTTATAACCCGACT
GTTTCTTACCAAAATCAGTCATGTCATTGTATCAGCAGTA
ATGGAGATAATAAAATATTTTGCATGTTAATGGAACACCG
TAATTGGTCAAACAGTGAATATCTGCGAATACATGTCCAC
TTCTGAAATCTGGGTTTGTTACTCCTCCTCTCTCCTGTTT
TGGATGTTTTTAGGACGGAGAGCTGTTAGTTCGTCTTTCC
TCCTAAACACTGTTCTCTCGTTGCACTGAATATTCGTGAT
CGGACGCTCCCATTGGACGACCGATCAACTAATATCTCTT
AATAGCTGTTCATTTTGTTTGCTCAATAAAGTTGCTGAAC
TATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ube2d2l-201 Contained in:
[BAC] CH73-349E16 (1)

Genome Resources: Vega_Trans:OTTDART00000049500 (1),  Ensembl_Trans:ENSDART00000168142 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC059548 (1) 1492 nt
GenBank:EH451412 (1) 991 nt
GenBank:EH552824 (1) 931 nt
GenBank:CK702875 (1) 920 nt
GenBank:CK687830 (1) 651 nt
CITATIONS (2)