Transcript

ube2d2l-201

ID
ZDB-TSCRIPT-110325-534
Name
ube2d2l-201
Previous Names
  • ube2d2-001
  • ube2d2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049500 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049500|OTTDARG00000034866|ZDB-GENE-030131-7384 ube2d2l|OTTDARP00000038828 ube2d2-001 LG_ CU929193.13 Danio rerio protein_coding KNOWN, 1525 bp
GAGAGAGAGAGGTGGAGACACAATCACACACGCTCATACA
TACCTATACAAGTGCTCATTGGAGAAGCTCAGGCCTTCCC
GTTCACACTCTCTGTAACTTTGCTCCTCGGCGGGATTATT
ATTGTCTGACCGCTGGACTTCCGCAGGTTTATTCAACGTT
CGCGGCTCGGTTTGTCGGTTTCCGGTTCTGCTCGTCGGGT
TTCTGTCGGATCTTCAGAGTCTGGCTAGCGAGCACAGCTA
ACCGCAGCTAGCCGGATAAACCTGCTCTGTCCTCGGCCTC
AGGAGCACATCACAACACACTATGGCATTAAAACGAATTC
ACAAGGAATTGACTGATCTGGGTCGGGATCCTCCAGCGCA
GTGCTCCGCGGGACCCGTCGGCGATGACTTGTTTCACTGG
CAAGCTACAATTATGGGTCCTAATGACAGTCCATATCAAG
GCGGTGTGTTTTTCTTGACTATTCATTTTCCTACAGACTA
CCCTTTCAAACCACCTAAGGTTGCGTTCACCACAAGAATT
TATCACCCAAATATTAACAGTAATGGCAGCATCTGTTTGG
ATATTCTAAGGTCACAGTGGTCTCCTGCATTAACTATCTC
TAAAGTTCTTTTGTCCATCTGCTCGCTGTTATGTGATCCA
AACCCAGATGATCCGTTAGTGCCAGAGATAGCACGTATCT
ATAAAACAGACAATGAAAAGTACAACAGAATAGCTCGGGA
ATGGACTCAAAAATACGCCATGTGATACCAGAGGAGCCAA
TCTGCAGTATAGCTGGAAAAAAAATCAACTTTTCTTATTA
TTTTCTTCTCCTCCTTTACTTTGTTTTTGTTGTTCTTCCC
TCAACGAATTGACGGATCCGGTGTAAATCCAGACCATATC
AGCTCTGCTCAGTCCTCCCGACCCCATCAGCAGTCATTCA
ATCACACTGTAAAAACACAACGAGACCACAACATGATAAA
GACCCACACTTTGTTTGGTGTTCAGAAAACGCTCGTGTCA
AAGAAGCATGTTTTAACTACGAGCTCAGCCATTTTTTATT
ACGGTACACACAGAGTGAAACGCTTCTGACTCCCGCCACT
GGCTATAGAGGTGCTATTCAAGAAGTCGATCTTTTGCTTT
CATGTTTTTATATGCTTTTACAATAGCAATGAGAACTTCG
GTCTGTGAAATATATATATATTCTTGCTTATAACCCGACT
GTTTCTTACCAAAATCAGTCATGTCATTGTATCAGCAGTA
ATGGAGATAATAAAATATTTTGCATGTTAATGGAACACCG
TAATTGGTCAAACAGTGAATATCTGCGAATACATGTCCAC
TTCTGAAATCTGGGTTTGTTACTCCTCCTCTCTCCTGTTT
TGGATGTTTTTAGGACGGAGAGCTGTTAGTTCGTCTTTCC
TCCTAAACACTGTTCTCTCGTTGCACTGAATATTCGTGAT
CGGACGCTCCCATTGGACGACCGATCAACTAATATCTCTT
AATAGCTGTTCATTTTGTTTGCTCAATAAAGTTGCTGAAC
TATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations