Transcript

guca1d-201

ID
ZDB-TSCRIPT-110325-530
Name
guca1d-201
Previous Names
  • guca1d-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049488 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049488|OTTDARG00000034860|ZDB-GENE-040724-231 guca1d|OTTDARP00000038819 guca1d-001 LG_ CU928848.11 Danio rerio protein_coding KNOWN, 744 bp
CAGACACCCCAGGTTTAGTGAGGAGGCCGGTTTGCTCCTC
TCCATCACAAAACAGGTGTCTGGACTAGCGACGGGACGAG
AGCCATGGGTAACAACCATGCCAGTCTGGATGACATCCTC
GCGGAGGACATGCACCACTGGTATAACAAATTCATGAGAG
AGTCTCCGTCAGGCCTCATCACTCTCTTTGAGCTCAAGTC
TATTCTGGGGCTGCAGGGAATGAATGAGGACGCCAACAGT
TACGTGGATCAGGTGTTCTGCACTTTCGACATGGACAGGG
ATGGATATATCGACTTTGTGGAGTACATCGCTGCTATTAG
CTTAATGCTCAAGGGAGAAATCAACCAGAAACTCAAGTGG
TACTTCAAACTTTTTGACCAGGATGGAAACGGGAAGATTG
ACAAGGACGAATTGGAAACAATATTTACAGCTATACAAGA
CATCACGAGAAATCGTGACATTGTGCCAGAGGAAATAGTG
GCCCTTATATTTGAAAAGATTGATGTTAACGGAGAGGGTG
AACTGACACTGGAAGAGTTCATCGAAGGAGCTAAAGAACA
TCCCGAAATTATGGATATGCTGAAGATATTGATGGACCTC
ACTCCAGTCCTATTAATAATTGTCGAAGGGCGACAGAAAT
AAATAAATGAATGAACGTTATGTTGCTTTGAACTTCATAG
TCAGGACAAAGAATGTTCCCTTTCTCAAATCAATGAAAAT
GGAGTTTGGCAGACCCACTCCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations