ZFIN ID: ZDB-TSCRIPT-110325-51
Transcript Name: ddx10-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043418 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043418|OTTDARG00000031217|ZDB-GENE-071022-2 ddx10|no_translation ddx10-003 LG_ CR450711.21 Danio rerio protein_coding KNOWN, 720 bp
AAAGTTGATGTCTGTTCAGCAGAAGTTGGAGGCCTTCCTG
GCGCAGGAAAAAGAGCAGAAAGAGCGAGCACAGAGGTGTT
TTGTGTCCTACCTCCGCTCCGTCTATCTGATGAAGAACAA
AGATGTCTTTGATGTGTTACAGCTCAAACTCCCTGAATAT
GCCATGTCTCTGGGTTTGGCGGTGGCACCACGGGTCCGTT
TCCTCCTAAAGGCCCAGCAGCAGAGAAGAACAGCAGCACA
GGACGACAGCAGCACTGCAGGACACCAGTCTGAAGATGAG
CTGCAGAGTTTCACAGCTCAACTCCAACAACAGAAGACCA
AATCTGAGCCCTCACAGTCTGAAGAAGAGGAAGATGATGA
TGACGATGATGATGAAGGTGATGATGATGATGAAGATATT
AAGGACCAGGATTCATTAAAGCCTCTTTCTCTACTCTGTG
GCTTTAATGAAGAGGATGATGATGATGACCAGAGAGAAGC
AGACCTGCTGACAGTCAAGTGTAAAGATGTGTTCAATGTC
AAAGAAGAGATCAAGGATGAGGAGGTAAATAAACAACACA
TCTGGTGTCGTTATGGTTAATCAACTCGAGTCATCAGATG
CTGGTGGCAAAAAGAGAAGCTTCAGCAGTGAGGATGAAGA
TGATGATGATGATGATGATGATGATGAAGAACAAACAACA
CAGAAAAGCAGAAAGAAGCCCAGGACAGAGCCCACAGTCA

ddx10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ddx10-203 (1)    Ensembl 2733
ncRNA ddx10-002 (1) 826
ddx10-003 720
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddx10-003 Contained in:
[BAC] DKEY-183I3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000043418 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI891217 (1) 712 nt
CITATIONS (1)