ZFIN ID: ZDB-TSCRIPT-110325-495
Transcript Name: si:ch73-334e23.1-004
Previous Name: ch73-334e23.1-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049375 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049375|OTTDARG00000034801|ZDB-GENE-110408-36 si:ch73-334e23.1|no_translation sox2ot-004 LG_none FP102167.4,CU468686.12 Danio rerio sense_overlapping NOVEL, 522 bp
ATTGTTGGTGGAGCTCACAGTGTTATTGTATTAAAAAGAG
CCATCTGTGCCAGAAACAATGGCTTCAAATTATCTCTGAA
TACCCGGTGAAAAAATATAAAGCTTTCTCCTTCTCATTAT
GTTTGGTGGGGGTTTTTGTAGACTTGCTATAAGTGACTTT
TGTTGTTCTTGATGCATTCTTCTTCTTTTTCAATCGGCCC
CTTTTCAGATGGCGTGGAGCTGCAGAGGGGCTGAGGCGGG
TGAGAGCAGCCGCGCTGAGAGCACTCTGAGCGGGCACACG
GAGCGACTGGACGCTATGGATCATGAGAGCGGCTGCCGGA
AAACTGCGCGGCCGGAAAAAGCGACTCCTCGCTGGGCGCG
CATGGGAGGATCCGGCCGGCAGGCGCGGGGAACTTTTGGA
TGTGTCAGTCAAAGTGAGTTGGAAACGAGGAGCGACACCA
CAGCGTTTATGTTTTGCCTGTAAATCTCTGCTCTGCTTGG
GGACATAAAACGGCCCAAATGCAATGAAGAACGCACGTCA
AG

si:ch73-334e23.1 TRANSCRIPTS
Type Name Length (nt) Analysis
antisense si:ch73-334e23.1-001 (1) 504
si:ch73-334e23.1-002 (1) 400
si:ch73-334e23.1-003 (1) 503
si:ch73-334e23.1-004 522
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-334e23.1-004 Contained in:
[BAC] CH73-242D14 (1), CH73-334E23 (1)

Genome Resources: Vega_Trans:OTTDART00000049375 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)