Transcript

gadd45aa-201

ID
ZDB-TSCRIPT-110325-448
Name
gadd45aa-201
Previous Names
  • gadd45aa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049222 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049222|OTTDARG00000034724|ZDB-GENE-040426-1501 gadd45aa|OTTDARP00000038626 gadd45aa-001 LG_ CU693482.7 Danio rerio protein_coding KNOWN, 1253 bp
TAATGTAACGCCTCGCAAAGTCATATTTAGCCGGTGACAG
CCAGAGAAAGAACACCAACGAGAACTCTTGTGGATTTATC
CAGGTCTCAAAGGAAAGTTATTCAAGTCCGTTCTGGATTT
TACATGCAACATGACTTTTGAAGAACTTAACGGAGATTAT
TCTATTGAAAGGATGAACTCGGTGATTAAGGCTCTGGAGG
AGGTCCTGCGCTCCGCATTACCGCAGGGATGTATTACAGT
CGGGGTTTACGAGGCTGCAAAGTCCCTCAATGTGGACCCT
GATAACGTGGTGCTGTGCATCCTGGCCACTGACGACGACG
ATGTGAAAGATGTGGCGCTTCAGATTCACTTCACTCTCAT
CCAGGCTTTCTGCTGCGAGAACGACATCAACATCCTGCGC
GTGAACAACACGCGGCGCCTCGCGAACATCCTCGGGGGCG
CAGGCATGCACGGGAGCGAGCAGATGGACTTGCACTGCAT
TCTGGTCACGGTTCCACATGCGTCCACATGGAAGAACCCG
GCTCTGGGAAAAGTGAACCGCTTCTGCAGAGAGAGCCGCT
GTATGGATCAGTGGGTGCCCATTATCAACCTTCCAGAGCG
ATGAGCAGAACTGAAACCCAAAATCGGGTGAAAAAACAAC
ACGAATCAAAAAATATCTAGCAAAAAAAGATAAAAGCTAA
AAAAGGTGGTCACAAAAAGGACTGAGAGTTCAGACCGGAC
GGAAGCTCCTTCAGAATACCCTGGAGAAGGAGGAGGAGGA
GCTCTCTCTTGCAATGATTCAGCAGTTTTTGGCTTTGTTT
GTGGGACTTTCTGAGGACGTCACATGAAGCTAATTGTGAA
TGGAAGTGAGCACCTGAGTATCTTGTGACAGTTTATTGAC
GGAGTGTCATAAAGCACTTCAGATAATGACAGGATAGCAG
ATTTCTCAGTGGACTGTTTTCCAAAGGGGGCTTCCCTTGT
TTGTAGATTTGCCATCAATTCTGAATAATATATCAGCAGT
ACTTGTTTATGAATGTTGCAAATGAAATGATTTTAAAGGG
ACTTGCTTCATAACCACTGAGATCAAAACTATGCATTCAT
GATATCCTGTACCATTTATTATTATTTCTTATTTTACATA
ATTGTTTTTTGTGGTCTTTAAATTATTTTATTATATTAAT
TTAAATGAGTATTTATGTACGACTTTTTATACTATTATAT
ATTGAACTGTGAAATGAGTTTTGTGTTGTAATAAAAAATA
CATTTAAACTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations