ZFIN ID: ZDB-TSCRIPT-110325-384
Transcript Name: si:dkey-85n7.8-201
Previous Names: dkey-85n7.8-001, si:dkey-85n7.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049025 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049025|OTTDARG00000034619|ZDB-GENE-110411-127 si:dkey-85n7.8|OTTDARP00000038470 DKEY-85N7.8-001 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 973 bp
GATACATCGATTTTCTGTGCAGCAGGAAACCCAGGGGTTG
AACCCAGTGGCCATCCTGCTCTCCTTCTCCCTCAGCTTCT
CTCTATCCCTGTCTACGGACATCCAAACACAGCACACAGC
TGAAGGGATGCTGACCTTTCTGAGGGGAGCAGTGCAGCCA
GTGATGGTCAGCAGGACAAGGGATATTGTCCACAAACGCA
ACTCCAGCATCTACAGCAAACCACCCAAAAACAAGATCGG
ACCTGGGCAAAGTTTCTTGATCATGTCTGTGTTTGCCGTT
GCCCTCCTGGCCCCCGCTGGCTGGATTCTACACCACATCC
CAGAATATCGAGAGAGAGCAAAAACACCACCATCCTGAAA
ACCATCCACTTCTGTCATGGTCAGCAGAAATCTGGCTTAC
CTCTAAAGCATTATTCACCTCCACAGAAACAATTCAATCA
TCAGTATCATGAGTACCTTCGGATGTAACAATATAATATT
AAAAATCTGTTATTGTAAAGATAACAATAATAAAATACAT
AACAGTCCTATCTACAATAAAAAAGATTGAAATGTTTATG
ATGCCCCATGTGAATGTAATAAGAAATATAATCCTGTGGT
GTTTAGTGCCTTAGGACTGTGGCCCTTAATGTAAGCAGTG
GCCCTTATTATATACGCTTTCCACTGCAATAAAGTGTGTT
TTATACCGTCTGTTTTGGTTGATAAGTTTCACTGGGATAA
TTGTTCTTGCCTTGAGGGCACCACTTAAAAGTATACACAG
AAGTTAGATTGCTTTTCTTGAGGAAAAATTCACTTTGATT
ATGTCCTATGAGTTTGTGGTGCAGATACTGATAATCATAG
ATGAAGTTTATTATAAGGCCGGTGGGCAAATTTGATCATG
AGTGGGGTTAAATTTACTAATGCCTTCTTCCCAAACCTCT
TTTGGTGTTAAAAAACTGCTGTCAGAATCTAGTAAAGACA
CAAGCTGAAAAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-85n7.8-201 Contained in:
OTHER si:dkey-85n7.8-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049025 (1)
  • Ensembl_Trans:ENSDART00000150072 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH441673 (1) 1006bp
    CITATIONS (2)