ZFIN ID: ZDB-TSCRIPT-110325-344
Transcript Name: lzts3b-201
Previous Names: ch73-368o6.2-001, lzts3b-001, prosapip1b-001, si:ch73-368o6.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048891 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048891|OTTDARG00000034540|ZDB-GENE-110411-249 lzts3b|OTTDARP00000038367 CH73-368O6.2-001 LG_ CU469500.10 Danio rerio protein_coding NOVEL, 2880 bp
CGGCAGAGGGGCGGGGCGGAGGTGGGTGTGTGGCTCAGCT
GATACACGCATCTACTGACTATCATCATCATCTTCATCAT
CATCATCAGCAGCATCATCATCACCAGAGACCTGCTGCTG
TCCGGAGCCTGCCAGTCGGATGGACGCGTCGCGGTGAACG
CGCCGGTGTGACGCGCGCGCGCGCGGTGCTGAAGCTGAGG
ACGCGTCGCCGCATCAGTCATGTGCTTTTCCTGCGATGTC
GAGATGAGAAGCGGAGAATGAAGGATAAAATGACGCTCCA
CGACCACTGCGACTCACTCGACTGGAAGTAAACCAGTTGT
GAGTGTGTGGGTGCGTCTGCAGTAATGGCCCCTGCGGCGG
CTGCTGGGGGCGAGTGACGCTCTGGTTCCCCAGTATGGGC
AGTGTGGGCAGCGGGGTGGCCGGTGAGCAGGAGTTTGCCA
TGAAGAGCGTGGGCACACGCACCACCCTCCCTCGTGGCCC
GCCGCTGTCCCGCCGTGGACCCTCTGACCGCAGCTGCAGC
GCCGAGCGGCTCCACCCGCACCCGTCCACATCCGAGGGCT
CCAGCGACGAGAGAGGAGGCAGCAGCACCACCACTGACAG
AGTCCTAGAGCGGGGACAGCTCAACATGGAGAGGGTTCCT
GCTAACCTGGACGCTCTGGAGGGAACTGCAGCGGGCCGGC
GGGACGGGCACAGATCCGGCAGAGGAGTGTCTCTGGATGC
TTGCGGTAATGTTGTGGGTCACGGAGCGGAGAAGAACCAT
GACGGTGCAGCACCGCTGAAAAGCAGAGATGGAAACATCA
GCAAAAGAGACGGTCGCACACCTCCCAAAATACTCACCGT
CTCTGGAAAACTGGAGCAGAACACCTCTGCTCTGGTTCGA
CCGTCCGCCTTTAAACCCGTGGTGCCCAAGAGTTTTCACT
CCATGCAGAATCTGGTTGGTCAGTCTGGAAGCGGTGGCGG
TCGCTCTGCTGGATCGGGTGGAGGCTCGGACGCCCCGCAG
TCTCTCTGTGAGCAGGACAGTCCTGAGCGAGACCCTTCAG
GGGGAAACGATGGCCAGGGCGGCATGTCTGACTCCGGACG
CAACTCTCTAACCAGCCTGCCCACGTATGCAGGTCCCAGT
TTGAGCTACGGCCCCGCTCAGGCCCTCGGGCCCCTCAGTG
CCTCCACCAGTCACATCAACAGACTAAGCTCTGCTGCTGC
CCCGCTGGAGAAAGGGGAGAAACCCAAATATCAGAACGGG
CTGAGCGTGTCTGACAGCGGGCAGTCGTCCTCCGGGAAGA
GCTGCTTATCGTATCACAGACTCTGCCATCTGACGGAGCC
CAGCGCAACCGTCCAGCCCTCGCCCTCCACCGACGACATC
ATCCAGGACTTGGAGGACCGGCTGTGGGAGAAGGAGCAGG
AGGTGATCCACATGCGGCGTAATCTGGACCAGAGTGAGGC
GGCCATCGCTCAGGTGTTTGAGGAGAAGCAGCGCGTGTGG
GAGCGGGAGATGGAGGATCTACGACAGAACTATGCCGGCC
GGCTCCAGCAGGTCACACACCGGGCCCAGCGCACGCAGCA
TGCCCTGCAGACACACATCGCACGCCTGCAGCAGGACAAG
GGCCGCCTGCAGGAGGAGATCAGCGCACTGCTGGCCCAGA
GAGAGGAACTTGAGCGCAAGTGTCTGGACTACCGCAAGGA
GCAGGCCGACATACTGCCCCGGCTGGAGGAGACCAAGTGG
GAGCTGTGTCAGAAAGCAGGTGAGATCTCTCTACTTAAGC
AGCAGCTCCGCGAGAGCCAGAATGAGGTGACGCAGCGGGC
CGGAGAGACGGTGGCTCTCAGGGGTCAAATGAAGGATCTG
AACGCCCAGCTGAAGGAGCGCGAGGACACCATGATCGGCC
TAAAGGACTCGTACAACAGCAAGAGCCGAGAGCTGGAGAG
ATGCGAAGGAGAGCTGAAGAGAACACTGGCGGAGGTGTCG
ATGTTGCGTGATAAGCTGGTGGTGTTCGAGTCTGAGGTTG
TGGGTCTGAAACGGGCTCTGAATGAGCTGAGCTGCAGAAG
CGATCACACCGCGGTTCTGAGCTCCATCAGCGGCAGCAGC
AGTTTACCGTGGGCCGGACTACACTCGCCTAGAACCCCCG
AACCCTTATCTGTGCTCGGCTCCACGGTCGAAACCTTCCT
CAGCTTGCAGAGTGACGAAGCCAAAGCGCAGCGGCAGGAG
GCGGGAGAGCTGCGGCGTCAGCTGGAGCGGCTGCAGGGCG
AGCTACACCTGGAGAAACAGCAGAGAGAGAGGCAGGCGCT
CACCTTTGCGCAGGAGAGACACACCTGGCAGGACGAGAAG
GAGCGCGTGCTGAAATATCAGGCGCAGCTGCAGCTCAGCT
ATGTAGAGACGCTGCAGAGAAATCAGGCGCTGGAGGAACG
TGTCGGACAGCTTGGAGCCAAAATGGCGCCAGGATCACCA
CCACCTATCAGCCTCTCCATCCCCGTCCCAGTGACCGTCA
CTCTGTCACCAGATGAGCTGAAACCGCCTGTCCTGCATCA
GCTGGCGCCTCCATGGCCAGGCCCGTCCCGGTTGGAGAGG
ATCGAGTCCACTGAGATTTAGACTTTGTAAAAGACAATCG
ACGTCTGTTCAGCGGAGACGCTTCTGTTTCTGAAGACCTG
AAGAGGAAGGAGAAATACACACTGAGTTTTTCATCTTGTT
TCTAGTCCAAATATCTAAGAATACTGAAATCAAGAAGCAT
TTTCTGGAGAAGTATAAAATATAATCTTGTATTCAGAAAT
AATGAGTTTTTTTGTTCAAACTAAATAAATTGTGAAATAA
TGTTGCTTGTTAGTTTTAATTAAGTTTATTTTACTTACTC
CATTATTAATTTGCTTGCCGTAAGGATAAACTCACCTAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lzts3b-201 Contained in:
[BAC] CH73-368O6 (1)

Genome Resources: Vega_Trans:OTTDART00000048891 (1),  Ensembl_Trans:ENSDART00000149276 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)