Transcript

itgb1b.2-201

ID
ZDB-TSCRIPT-110325-308
Name
itgb1b.2-201
Previous Names
  • itgb1b.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048723 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048723|OTTDARG00000034441|ZDB-GENE-040426-2598 itgb1b.2|OTTDARP00000038219 itgb1b.2-001 LG_ CU693495.8 Danio rerio protein_coding KNOWN, 2270 bp
CTCAGACTGTATGAACAAAGTAAACTACACTCAAACTTTA
CTTCAATATTTCAGAAACGTCCTGTAAATTTATACTGTGA
ACATTTATTTACAACACAACTTCAGGAGGAGCCTTAGCAG
TAGCTACATATCAAGATGGATATAACAGTTTTGTTATTAT
CAGCTCTGCTAGGATTTGTTTCTTATGTCGGTGCTAACAC
AGACAGTAATCCATGCATTTCTGCAAATGCCAAAACCTGT
GGAGAGTGTATTCAGATCGGCCCACAGTGTGTGTGGTGCA
AAGATCCTGATTTCAAACCTTCACGCTGTGATGACATTGA
GTCCATGGCGAAAGCTGGCTGCACTGCAGACGGTGTAGAA
AACCCTCGAGGAGCGGTCACTATTGACAAGAACAAACCCG
TCACAAACCGTAAAACTGATGGAGGACAGAATCTGAGGCC
CGATGAAATCACGCAGATTCAGCCACAGAAAGTCAAGCTG
AACCTTCGCTCAGGAGAAGCACAGAAGTTTACTCTCAAGT
TTAAGAGGGCAGAGGATTATCCCATTGATCTGTACTTCCT
GATGGACCTCAGTCACTCTATGCTGAGCAATTTGGAAAAT
TTCAAAAACCTGGGAACCGAACTCGCCAATGAGATGAAGG
ACATCACGAAAGACCTGCGTATAGGTTTTGGTTCATTCTT
TAGGAAACCTTCCATTCAGACGAACCCATGTTTTCCAGAT
AATTGCATAGCTCCATTCAGTTACTTTAATGTACTGAGCT
TGACGGACGATCATGCATTGTTTACACAAGAAATCAGCAA
GCTGAAAACCTCTGGAAACCTGGATTCTTCAGAGGCAGGA
TTAGAGGCATTGATGCAGGCTGCTGTCTGCACGGACGTGA
TTGGCTGGAGGAATGTCACTCGTCTCCTTGTGTTTTTCAC
GGATGCTGGACTGCGTTTTTCTGGTGATGGAAAACGAGGT
GGCATTGTTCGTCTAAATGATGGGAAATGCCTTCTTGACG
ATAATATGTACACCAGAAGTGACTACTCTGACTACCCCAG
CCTCTCTCAGCTGGTAGACACAGTTACTGACAATAGCATT
CACACTATCTTTGCTGTGACAGAGCAGTATCGGGATCTTT
ATCAGGAGCTGTCTGCTAAAGTGCCTAACTCAGCAGTGGG
GACACTCTCCACCAGTGGGGACAATCTGGCTAAGCTCGTC
ATTGATGCATTAATTCCTCTGTCCTCTGAGGTGATTGTGG
AGAACAGCAAGCTACCTGATGGTGTGTCCATCTCTTACGT
CTCCCACTGCAAGAACGGAGTGAATGGAAGAGGAGAAGAT
GGGAGAAAGTGCTCCAACATCTCCATTGGGGATGAGGTGT
TGTTTGATATAGAAATCACGGCTAAAGGCTGTCCGTCTAA
AGGTAAACCAGAGACCATAAAGATCAAGCCACTGGGGTTC
AGCGAGGAGGTGGAGATCTTTCTCAACTACATCTGTGAAT
GTGAGTGTCACAAAGACGGGATCAAAAACAGCCCCGAGTG
TAGCGGAGGACAGGGAACGCTGGAGTGTGGAGTCTGCAGG
TGTAATGAAGGTCGATCTGGCAGAATTTGTGAGTGCACCC
AGGATCTGGATGCATACTGCCAGATGGATATGTCGTCAGG
CATCTGCAGCAACAATGGCGAATGTGTCTGTGGAACCTGT
GAGTGTAAGAAAAGAGAAAACCCGGAGGAGAGATACAGCG
GAAGGTACTGCGAGTGCAACAACTTCAGCTGCGACCGCTT
CAACAACAAGCTCTGTGGAGGTCACGGTCGATGTATGTGC
GGGCAGTGTGCATGTGAATTTAACTACGCCGGCAGTGCAT
GCCAATGCTCTATGGATACCTCGAGCTGTCTGGCCAGTAA
CAAACTGATCTGTAATGGACACGGCATCTGTGAATGTGGA
CAGTGTAAATGTTTGGACAATTGTCAAGGTCCAACCTGTG
AAATCTGCCTAACCTGAAACAGTGGTGTGAAAAGGAAAAA
ACTGACACCTGAAAGCATATCCCTCAATTTATACTGTACA
TCATATTGAGACACATGTTATACATTTTAATTATTGAGTG
TCATCATAGGTCAGTAAGATGATGTTGGTTGATGCAATAT
GTTTGCATGTTATTATAACCTACGAAACAGGTTATGATCT
TACAGTATATACAAGATTTATACAATTTATATTTTTAGAA
ATGCTGTGATGCAAAAATACTACACAGAGTGAATTGTCTT
AATGCCTGGGATTAAATATGGGTGTTTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations