header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-2701
Transcript Name: serpinf2b-201
Previous Names: ch73-297d15.2-001, serpinf2b-001, zgc:158410-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051097 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051097|OTTDARG00000035855|ZDB-GENE-061215-114 serpinf2b|OTTDARP00000040160 serpinf2b-001 LG_ CU861670.6 Danio rerio protein_coding KNOWN, 1803 bp
GCTAAAGATCAATGAAAGTTGAAATGTAACTGCGTGCTGC
GAGACTGCCAACCCCTACAGACAAGAATTTTCCCGTTGCC
TGTTTTGTGTGTTTCTTTCCCAAATCAGGGCTGGATCCCA
CTCCTGGAGATTTGCACGACTAACTTCTAGAACATGAACT
TGTGTTTTCTGGCATTCCTCCTCCTTTGTTACTCCAAGCA
AGGCTGGACGGACGATGTGACTGATCCAGAGGATGGAGTG
GATCCTGTAATTCCTCTCATTCCACTGACTCCAAGTAAAC
CCATATCAGATTTGAAGGCCACTCTTGACCCCACTGTAAC
AGAAGAACTCACAGTTAATCCAGATGGCCTGGAAGCAGAT
CCTCCAACACCAGGTCCCTCTAGTGGGCAGAAAGAGGGAT
CGTCGGAGGAAGAGCTTGATACCCTTTGTGATGGGGACAT
GACAGGCAAACAGATAAAACGGACCATAGGCAACGGCATT
ATGAAGCTTGGCCTTTTGTTCCTGGAAAACTTGAAGCCTA
GTCCAGATCAACCTAATGTCATCTTTTCTCCTCTTAGCTT
GTCGGTAGCACTCTCACAGCTAGCACTGGGAGCAACGAAT
GATACAGAAGAGCTGCTTCTACATCACCTGCATGCCGATG
CTCTGCCCTGCTATCACACTGCCCTCAGCAGCCTACTGCG
CAACTTCCGCAAAAGGAGCATGCCAATCGCCAGCCGCATC
TATCTGAAAACGGGATTTAAAGCGAAGTCTGACTTTATGG
AAGATTCTCAGAAACTGTATGACTCAGAGCCGGCCACTTT
GACTGATGTTAATGACGTCAATGAATGGGTCAAGAAAGTC
ACAAATGGGCACATCTCAGAGTTTTTGTCCAGCCTGCCTC
CCAGCGCTGTTATGATGCTCATCAATGCTATGCACTACAA
AGGAGAGTGGCTCACACGCTTTGACCCTCATTTCACCTCC
ACTGAGAATTTCTACATAGATGAAAACCAGATTGTTAATG
TGGACATGATGCTTGGGCCAAAGTATCCTCTCAGCGTGTT
CACCCATCATGAGCTTGATGCCCAGGTTGCTCGATTCCCT
TTTAAAGGCGATAGGAGTCTCTTGGTGGTAATGCCAACAT
CTGGACATGTGAACGTGTCAGCCATCGCAGCAAAGCTCAA
TATATCAGATCTTTACAGTCGATTGCCACGAGAAAGAAAC
ATGCAGGTCAAACTACCTAAATTTAAACTCGATTTCAACC
AGGACCTCCAAGAGGCCATGACAAGCATGGGTTTAGGAAA
GCTGTTTAGTCACCCAAAGCTTGATCGCATCACAGAGGTC
CCCTTGTTTGTGTCCAGTGTGCAGCATATGTCCAGCGTTG
AGATAAATGAAGAGGGGGCAGAGGCAGTGGCCGCAACAAG
TGTGGTCATCTCACGTTCCAATCCTTCATTTACTGTCAAC
CAGCCATTTTTCTTTGCCCTGATGGATGATTTGAGTCAAA
CACCATTGTTCCTCGGAGTAATTTCCAATCCAAACCCTGG
AGCATCCACTATGATCACAAACCCTGGCAATGCAGACAAA
ACTGATGACAAGCCTTTTGAGGTTCATCCAAAATAGATTA
TTTTCATGCTCTTACAAAATGAGTCTATAAGCGATTGCTG
ACTATGTAGTCTGTCCCCACTGGGAGGCAGATTTAGTATA
TCTACTTAAAGTAAATTTTTTAAGATCATTTGAAATTACT
ACCCCCTGTATGAATTAATTTTCTAAATGCACTAATCTTG
TTTAAAAATGGTCATGATTTCTTTTTTCTTTCTTTCTTTC
TTT

serpinf2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA serpinf2b-201 1803
serpinf2b-202 (1)    Ensembl 623
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
serpinf2b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000051097 (1),  Ensembl_Trans:ENSDART00000150152 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC128864 (1) 1762 bp
GenBank:CF595408 (1) 832 bp
CITATIONS (2)